Mutant Report for Mutant ID: 39115
Strain: PA14 Genetic Background: Wild Type Transposon: MrT7 Library: lib_04_04
Raw Sequence ID: 22876
Chromat Path: H:\Pa14\MrT7\408v1\408v1_D07_D7_059.ab1 Last Transposon Base: 65 Transposon Sequence
Match Quality: 2
Raw Sequence:
(Transposon Sequence in Red)		 
TGTTCAGTTTGTATACGACTCACTATAGTCTTCTGCAGACCGGGGCACTTATCAGCCAACCTGATAACTG
ACCCGACTGCCTGGATCGGCCTGGCGACCCTGATCGGGCTGGAGATCGACCTCGGCATCGACAACCTGGT
GTTCATCGCGATCCTCGCCGACAAGCTGCCGCCGCACCTGCGCGACCGCGCCCGGGTCCTCGGCCTGTCG
CTGGCGCTGCTGATGCGCCTGGGCCTGCTGGCGAGCATCTCGTGGATGGTGACCCTCACCGAGCCGCTGT
TCGAGGTATTCGGCAAGAGCTTCTCCGGCCGCGACCTGATCATGCTGTTCGGTGGCGTGTTCCTGCTGTT
CAAGGCCACCATGGAGCTGCACGAACGCCTCGAAGGCCATGTCGCCCAGCACGCCGGCAACAAGACCTAC
GCGCTGTTCTGGCCGATCGTCGCGCAGATCGTGGTGCTCGACGCGGTGTTCTCGCTCGACGCGGTGATCA
CCGCAGTGGGCATGGTCGAGCACCTGGAAGTGATGATGATCGCGGTGATCGTCTCCATCGGACTGATGAT
CGTCGCCAGCAAGCCGCTGACCCGCTTCGTCAATCGTCACCCGACGGTGATCATGCTGGAGCCTGGGCAT
CCCTGATAATGTACGGCTTACAGCCTGACCGGCGAGGAGCCTGGGCTTCCATATTCCGAAAGGCAACTCT
GTCGGAGCCTTAGGCGATTTGGTTCGCCACTGTAGAGTTTAAGAATATGGAGGAGCAGACATCCAGCCAA
ATATAGACTTTGAAAGGGTCCCTATCTTAGGCACGATGTAGTCGCCACATAGCAAACTTACACCACCATC
AGCGACGCACAAACTAGATAGTCCAAAATATATGTGCACAGAAAGCATCTCAATTTGCCTCCAGGAGGCG
ATACATTCAATGTTCATGGTATACCAGGN
Blast against PA14
Processed Seqquence ID: 17060
5' Trim Position: 79 3' Trim Position: 591
Processed Sequence:
(Transposon Sequence in Red)		 
CCTGGATCGGCCTGGCGACCCTGATCGGGCTGGAGATCGACCTCGGCATCGACAACCTGGTGTTCATCGC
GATCCTCGCCGACAAGCTGCCGCCGCACCTGCGCGACCGCGCCCGGGTCCTCGGCCTGTCGCTGGCGCTG
CTGATGCGCCTGGGCCTGCTGGCGAGCATCTCGTGGATGGTGACCCTCACCGAGCCGCTGTTCGAGGTAT
TCGGCAAGAGCTTCTCCGGCCGCGACCTGATCATGCTGTTCGGTGGCGTGTTCCTGCTGTTCAAGGCCAC
CATGGAGCTGCACGAACGCCTCGAAGGCCATGTCGCCCAGCACGCCGGCAACAAGACCTACGCGCTGTTC
TGGCCGATCGTCGCGCAGATCGTGGTGCTCGACGCGGTGTTCTCGCTCGACGCGGTGATCACCGCAGTGG
GCATGGTCGAGCACCTGGAAGTGATGATGATCGCGGTGATCGTCTCCATCGGACTGATGATCGTCGCCAG
CAAGCCGCTGACCCGCTTCGTC
Blast against PA14
BLAST of Processed Sequence against PA14 And PAO1 Genome Sequence
77142 77142 77143 77143 77144 77144 77145 77145 77146 77146 77147 77147 77148 77148 77149 77149 77150 77150 77151 77151 77152 77152 77153 77153 77154 77154 77155 77155 77156 77156 77157 77157 77158 77158 77159 77159
PA14 BLAST Hit ID: 77142       Show Transposon Map
Identities: 508/512 (99.21%) BLAST Bit Score: 983.0 Percent of Processed Sequence That Aligns: 99.80%
Query Start: 1 Query End: 512 Subject Start: 4190213 Subject End: 4190724 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 4190213 PA14_47040 +
Raw Sequence Start: 4190134
Extrapolated Insert Location: 4190199 PA14_47040 +
Default Offset Location: 4190197 PA14_47040 +
PA14 BLAST Hit ID: 77143       Show Transposon Map
Identities: 65/78 (83.33%) BLAST Bit Score: 52.0 Percent of Processed Sequence That Aligns: 15.04%
Query Start: 210 Query End: 287 Subject Start: 6183999 Subject End: 6183922 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 6183999 PA14_69320 +
Raw Sequence Start: 6184287 PA14_69330 +
Extrapolated Insert Location: 6184222 PA14_69320 +
Default Offset Location: 6184224 PA14_69320 +
PA14 BLAST Hit ID: 77144       Show Transposon Map
Identities: 50/59 (84.74%) BLAST Bit Score: 46.1 Percent of Processed Sequence That Aligns: 11.33%
Query Start: 210 Query End: 268 Subject Start: 6431330 Subject End: 6431388 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 6431330 PA14_72180,PA14_72190* +,+
Raw Sequence Start: 6431042 PA14_72170 +
Extrapolated Insert Location: 6431107 PA14_72180,PA14_72190* +,+
Default Offset Location: 6431105 PA14_72180,PA14_72190* +,+
PA14 BLAST Hit ID: 77145       Show Transposon Map
Identities: 26/27 (96.29%) BLAST Bit Score: 46.1 Percent of Processed Sequence That Aligns: 5.08%
Query Start: 30 Query End: 56 Subject Start: 6431150 Subject End: 6431176 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 6431150 PA14_72180,PA14_72190* +,+
Raw Sequence Start: 6431042 PA14_72170 +
Extrapolated Insert Location: 6431107 PA14_72180,PA14_72190* +,+
Default Offset Location: 6431105 PA14_72180,PA14_72190* +,+
PA14 BLAST Hit ID: 77146       Show Transposon Map
Identities: 28/30 (93.33%) BLAST Bit Score: 44.1 Percent of Processed Sequence That Aligns: 5.66%
Query Start: 402 Query End: 431 Subject Start: 2425382 Subject End: 2425411 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 2425382 PA14_28010 +
Raw Sequence Start: 2424902
Extrapolated Insert Location: 2424967 PA14_28010 +
Default Offset Location: 2424965 PA14_28010 +
PA14 BLAST Hit ID: 77147       Show Transposon Map
Identities: 21/21 (100.00%) BLAST Bit Score: 42.1 Percent of Processed Sequence That Aligns: 3.91%
Query Start: 123 Query End: 143 Subject Start: 5394789 Subject End: 5394769 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 5394789 PA14_60530 +
Raw Sequence Start: 5394990
Extrapolated Insert Location: 5394925
Default Offset Location: 5394927
PA14 BLAST Hit ID: 77148       Show Transposon Map
Identities: 35/40 (87.50%) BLAST Bit Score: 40.1 Percent of Processed Sequence That Aligns: 7.62%
Query Start: 17 Query End: 56 Subject Start: 6184192 Subject End: 6184153 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 6184192 PA14_69320 +
Raw Sequence Start: 6184287 PA14_69330 +
Extrapolated Insert Location: 6184222 PA14_69320 +
Default Offset Location: 6184224 PA14_69320 +
PA14 BLAST Hit ID: 77149       Show Transposon Map
Identities: 23/24 (95.83%) BLAST Bit Score: 40.1 Percent of Processed Sequence That Aligns: 4.49%
Query Start: 122 Query End: 145 Subject Start: 4041462 Subject End: 4041439 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 4041462 PA14_45370,PA14_45360* +,-
Raw Sequence Start: 4041662 PA14_45370,PA14_45360* +,-
Extrapolated Insert Location: 4041597 PA14_45370,PA14_45360* +,-
Default Offset Location: 4041599 PA14_45370,PA14_45360* +,-
PA14 BLAST Hit ID: 77150       Show Transposon Map
Identities: 20/20 (100.00%) BLAST Bit Score: 40.1 Percent of Processed Sequence That Aligns: 3.71%
Query Start: 28 Query End: 47 Subject Start: 2336705 Subject End: 2336724 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 2336705 PA14_26860 +
Raw Sequence Start: 2336599 PA14_26860 +
Extrapolated Insert Location: 2336664 PA14_26860 +
Default Offset Location: 2336662 PA14_26860 +
PAO1 BLAST Hit ID: 77151       Show Transposon Map
Identities: 506/512 (98.82%) BLAST Bit Score: 967.0 Percent of Processed Sequence That Aligns: 99.80%
Query Start: 1 Query End: 512 Subject Start: 1444426 Subject End: 1443915 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 1444426 PA1331 +
Raw Sequence Start: 1444505
Extrapolated Insert Location: 1444440 PA1331 +
Default Offset Location: 1444442 PA1331 +
PAO1 BLAST Hit ID: 77152       Show Transposon Map
Identities: 65/78 (83.33%) BLAST Bit Score: 52.0 Percent of Processed Sequence That Aligns: 15.04%
Query Start: 210 Query End: 287 Subject Start: 5911785 Subject End: 5911708 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 5911785 PA5250 +
Raw Sequence Start: 5912073 PA5251 +
Extrapolated Insert Location: 5912008 PA5250 +
Default Offset Location: 5912010 PA5250 +
PAO1 BLAST Hit ID: 77153       Show Transposon Map
Identities: 50/59 (84.74%) BLAST Bit Score: 46.1 Percent of Processed Sequence That Aligns: 11.33%
Query Start: 210 Query End: 268 Subject Start: 6158412 Subject End: 6158470 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 6158412 PA5469 +
Raw Sequence Start: 6158124 PA5468 +
Extrapolated Insert Location: 6158189 PA5469 +
Default Offset Location: 6158187 PA5469 +
PAO1 BLAST Hit ID: 77154       Show Transposon Map
Identities: 26/27 (96.29%) BLAST Bit Score: 46.1 Percent of Processed Sequence That Aligns: 5.08%
Query Start: 30 Query End: 56 Subject Start: 6158232 Subject End: 6158258 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 6158232 PA5469 +
Raw Sequence Start: 6158124 PA5468 +
Extrapolated Insert Location: 6158189 PA5469 +
Default Offset Location: 6158187 PA5469 +
PAO1 BLAST Hit ID: 77155       Show Transposon Map
Identities: 28/30 (93.33%) BLAST Bit Score: 44.1 Percent of Processed Sequence That Aligns: 5.66%
Query Start: 402 Query End: 431 Subject Start: 3148868 Subject End: 3148839 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 3148868 PA2792 +
Raw Sequence Start: 3149348
Extrapolated Insert Location: 3149283 PA2792 +
Default Offset Location: 3149285 PA2792 +
PAO1 BLAST Hit ID: 77156       Show Transposon Map
Identities: 21/21 (100.00%) BLAST Bit Score: 42.1 Percent of Processed Sequence That Aligns: 3.91%
Query Start: 123 Query End: 143 Subject Start: 5122323 Subject End: 5122303 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 5122323 PA4574 +
Raw Sequence Start: 5122524
Extrapolated Insert Location: 5122459
Default Offset Location: 5122461
PAO1 BLAST Hit ID: 77157       Show Transposon Map
Identities: 35/40 (87.50%) BLAST Bit Score: 40.1 Percent of Processed Sequence That Aligns: 7.62%
Query Start: 17 Query End: 56 Subject Start: 5911978 Subject End: 5911939 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 5911978 PA5250 +
Raw Sequence Start: 5912073 PA5251 +
Extrapolated Insert Location: 5912008 PA5250 +
Default Offset Location: 5912010 PA5250 +
PAO1 BLAST Hit ID: 77158       Show Transposon Map
Identities: 20/20 (100.00%) BLAST Bit Score: 40.1 Percent of Processed Sequence That Aligns: 3.71%
Query Start: 28 Query End: 47 Subject Start: 3232653 Subject End: 3232634 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 3232653 PA2879 +
Raw Sequence Start: 3232759 PA2879 +
Extrapolated Insert Location: 3232694 PA2879 +
Default Offset Location: 3232696 PA2879 +
PAO1 BLAST Hit ID: 77159       Show Transposon Map
Identities: 23/24 (95.83%) BLAST Bit Score: 40.1 Percent of Processed Sequence That Aligns: 4.49%
Query Start: 122 Query End: 145 Subject Start: 1603353 Subject End: 1603376 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 1603353 PA1476 +
Raw Sequence Start: 1603153 PA1476 +
Extrapolated Insert Location: 1603218 PA1476 +
Default Offset Location: 1603216 PA1476 +
H PA14 Blast Hit H PAO1 Blast Hit