Mutant Report for Mutant ID: 38960
Strain: PA14 Genetic Background: Wild Type Transposon: MrT7 Library: lib_04_04
Raw Sequence ID: 22721
Chromat Path: H:\Pa14\MrT7\406v1\406v1_G08_G8_066.ab1 Last Transposon Base: 64 Transposon Sequence
Match Quality: 0
Raw Sequence:
(Transposon Sequence in Red)		 
TGTTCAGTTTGTATACGACTCACTATAGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTATCCCA
TCGCCGGCTCGGCCTATTCCTATACCAGCCTCAGCTTCCGCCCCTGCGTCTGCTTACTCGCCGGCTGGTC
GCTGCTGCTCGACTACCTGTTCCTGCCGATGATCAACTACCTGCTCATCGGCCTGTTCCTCAACATCGCC
TTCCCGATGGTGCCGGCCTGGGTCTTCGTGCTCACGGCGATCGGCCTGGTCACCGTGCTCAACGTGATCG
GCATCAGCTCGGTGGCCGGCATGAGCAACGTGATCGTCGGCGCCCAGTTCGTCTTCGCCGTGGTGTTCGT
CGCCATGGCGGTCAAGCACCTGGCCGGCATCCCCTCGCTGGACCTGAGCCTGCCCTTCGTCGGCGACGGC
AGCCAGCCGGGCTTCGCCCCGTTGATGGCCGGCGCGGCGGTGCTGTGCCTGTCGTTCCTCGGCTTCGACG
CGGTCTCGACCCTGGCCGAGGAAACCCGCGACCCGCAACGCGACATACCGCCCCCCATCATCATCTGAGG
GGCCTGGCCAAANNNNNNNNNNNCNNNNGNNNNNNGNNNNNNNNNCNNNGGNGGNNNNNNGGNNNNNNNN
NNCNNGGNNGNCGGGNCNGNGGGCGGNGNNGGGNNGCNGGGGGGCGGGGGCCNGCCCCCCCGCGGGCNNN
CGCCCCGCCCGCCCGCGGGGCCGGGCCGCCCCGGCCCGGNCCGGGCCCCGGGCGCCTCCGGGGCCGCCCC
CCCCCGCCGCGCCGGGCCCCGGGCGGNCCCCGGCCCCGCCGGCGGGTTCGCCGGCCCCCCGGGGGGCCCC
GGGGCGGCGGGGCGCGGGTCCGGGGGGCCCCGGGCCTTTCCTGCTGGGGGTGGGTTCTTTCTTCTCTCCC
TGGT
Blast against PA14
Processed Seqquence ID: 16907
5' Trim Position: 4 3' Trim Position: 564
Processed Sequence:
(Transposon Sequence in Red)		 
CAGTTTGTATACGACTCACTATAGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTATCCCATCGC
CGGCTCGGCCTATTCCTATACCAGCCTCAGCTTCCGCCCCTGCGTCTGCTTACTCGCCGGCTGGTCGCTG
CTGCTCGACTACCTGTTCCTGCCGATGATCAACTACCTGCTCATCGGCCTGTTCCTCAACATCGCCTTCC
CGATGGTGCCGGCCTGGGTCTTCGTGCTCACGGCGATCGGCCTGGTCACCGTGCTCAACGTGATCGGCAT
CAGCTCGGTGGCCGGCATGAGCAACGTGATCGTCGGCGCCCAGTTCGTCTTCGCCGTGGTGTTCGTCGCC
ATGGCGGTCAAGCACCTGGCCGGCATCCCCTCGCTGGACCTGAGCCTGCCCTTCGTCGGCGACGGCAGCC
AGCCGGGCTTCGCCCCGTTGATGGCCGGCGCGGCGGTGCTGTGCCTGTCGTTCCTCGGCTTCGACGCGGT
CTCGACCCTGGCCGAGGAAACCCGCGACCCGCAACGCGACATACCGCCCCCCATCATCATCTGAGGGGCC
Blast against PA14
BLAST of Processed Sequence against PA14 And PAO1 Genome Sequence
76319 76319 76320 76320 76321 76321 76322 76322 76323 76323 76324 76324 76325 76325 76326 76326 76327 76327 76328 76328 76329 76329 76330 76330 76331 76331 76332 76332
PA14 BLAST Hit ID: 76319       Show Transposon Map
Identities: 485/492 (98.57%) BLAST Bit Score: 920.0 Percent of Processed Sequence That Aligns: 87.68%
Query Start: 60 Query End: 551 Subject Start: 376763 Subject End: 376272 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 376763 PA14_04200*,PA14_04210 -,+
Raw Sequence Start: 376826 PA14_04200*,PA14_04210 -,+
Extrapolated Insert Location: 376762 PA14_04200*,PA14_04210 -,+
Default Offset Location: 376763 PA14_04200*,PA14_04210 -,+
PA14 BLAST Hit ID: 76320       Show Transposon Map
Identities: 42/44 (95.45%) BLAST Bit Score: 71.9 Percent of Processed Sequence That Aligns: 7.68%
Query Start: 124 Query End: 167 Subject Start: 1524618 Subject End: 1524661 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 1524618 PA14_17740 +
Raw Sequence Start: 1524491 PA14_17740 +
Extrapolated Insert Location: 1524555 PA14_17740 +
Default Offset Location: 1524554 PA14_17740 +
PA14 BLAST Hit ID: 76321       Show Transposon Map
Identities: 50/55 (90.90%) BLAST Bit Score: 69.9 Percent of Processed Sequence That Aligns: 9.64%
Query Start: 468 Query End: 522 Subject Start: 1524962 Subject End: 1525016 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 1524962 PA14_17740 +
Raw Sequence Start: 1524491 PA14_17740 +
Extrapolated Insert Location: 1524555 PA14_17740 +
Default Offset Location: 1524554 PA14_17740 +
PA14 BLAST Hit ID: 76322       Show Transposon Map
Identities: 43/46 (93.47%) BLAST Bit Score: 67.9 Percent of Processed Sequence That Aligns: 8.04%
Query Start: 128 Query End: 173 Subject Start: 3401688 Subject End: 3401643 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 3401688 PA14_38130,PA14_38120* +,+
Raw Sequence Start: 3401819 PA14_38130,PA14_38120* +,+
Extrapolated Insert Location: 3401755 PA14_38130,PA14_38120* +,+
Default Offset Location: 3401756 PA14_38130,PA14_38120* +,+
PA14 BLAST Hit ID: 76323       Show Transposon Map
Identities: 40/44 (90.90%) BLAST Bit Score: 56.0 Percent of Processed Sequence That Aligns: 7.68%
Query Start: 465 Query End: 508 Subject Start: 6475601 Subject End: 6475644 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 6475601 PA14_72710 +
Raw Sequence Start: 6475133 PA14_72710 +
Extrapolated Insert Location: 6475197 PA14_72710 +
Default Offset Location: 6475196 PA14_72710 +
PA14 BLAST Hit ID: 76324       Show Transposon Map
Identities: 30/32 (93.75%) BLAST Bit Score: 48.1 Percent of Processed Sequence That Aligns: 5.54%
Query Start: 124 Query End: 155 Subject Start: 6475257 Subject End: 6475288 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 6475257 PA14_72710 +
Raw Sequence Start: 6475130 PA14_72710 +
Extrapolated Insert Location: 6475194 PA14_72710 +
Default Offset Location: 6475193 PA14_72710 +
PA14 BLAST Hit ID: 76325       Show Transposon Map
Identities: 42/48 (87.50%) BLAST Bit Score: 48.1 Percent of Processed Sequence That Aligns: 8.39%
Query Start: 471 Query End: 518 Subject Start: 3401342 Subject End: 3401295 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 3401342 PA14_38130,PA14_38120* +,+
Raw Sequence Start: 3401816 PA14_38130,PA14_38120* +,+
Extrapolated Insert Location: 3401752 PA14_38130,PA14_38120* +,+
Default Offset Location: 3401753 PA14_38130,PA14_38120* +,+
PAO1 BLAST Hit ID: 76326       Show Transposon Map
Identities: 484/492 (98.37%) BLAST Bit Score: 912.0 Percent of Processed Sequence That Aligns: 87.68%
Query Start: 60 Query End: 551 Subject Start: 362593 Subject End: 362102 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 362593 PA0322 +
Raw Sequence Start: 362656 PA0322 +
Extrapolated Insert Location: 362592 PA0322 +
Default Offset Location: 362593 PA0322 +
PAO1 BLAST Hit ID: 76327       Show Transposon Map
Identities: 42/44 (95.45%) BLAST Bit Score: 71.9 Percent of Processed Sequence That Aligns: 7.68%
Query Start: 124 Query End: 167 Subject Start: 4033390 Subject End: 4033347 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 4033390 PA3597 +
Raw Sequence Start: 4033517 PA3597 +
Extrapolated Insert Location: 4033453 PA3597 +
Default Offset Location: 4033454 PA3597 +
PAO1 BLAST Hit ID: 76328       Show Transposon Map
Identities: 50/55 (90.90%) BLAST Bit Score: 69.9 Percent of Processed Sequence That Aligns: 9.64%
Query Start: 468 Query End: 522 Subject Start: 4033046 Subject End: 4032992 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 4033046 PA3597 +
Raw Sequence Start: 4033517 PA3597 +
Extrapolated Insert Location: 4033453 PA3597 +
Default Offset Location: 4033454 PA3597 +
PAO1 BLAST Hit ID: 76329       Show Transposon Map
Identities: 43/46 (93.47%) BLAST Bit Score: 67.9 Percent of Processed Sequence That Aligns: 8.04%
Query Start: 128 Query End: 173 Subject Start: 2232512 Subject End: 2232557 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 2232512 PA2041 +
Raw Sequence Start: 2232381 PA2041 +
Extrapolated Insert Location: 2232445 PA2041 +
Default Offset Location: 2232444 PA2041 +
PAO1 BLAST Hit ID: 76330       Show Transposon Map
Identities: 40/44 (90.90%) BLAST Bit Score: 56.0 Percent of Processed Sequence That Aligns: 7.68%
Query Start: 465 Query End: 508 Subject Start: 6202362 Subject End: 6202405 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 6202362 PA5510 +
Raw Sequence Start: 6201894 PA5510 +
Extrapolated Insert Location: 6201958 PA5510 +
Default Offset Location: 6201957 PA5510 +
PAO1 BLAST Hit ID: 76331       Show Transposon Map
Identities: 30/32 (93.75%) BLAST Bit Score: 48.1 Percent of Processed Sequence That Aligns: 5.54%
Query Start: 124 Query End: 155 Subject Start: 6202018 Subject End: 6202049 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 6202018 PA5510 +
Raw Sequence Start: 6201891 PA5510 +
Extrapolated Insert Location: 6201955 PA5510 +
Default Offset Location: 6201954 PA5510 +
PAO1 BLAST Hit ID: 76332       Show Transposon Map
Identities: 42/48 (87.50%) BLAST Bit Score: 48.1 Percent of Processed Sequence That Aligns: 8.39%
Query Start: 471 Query End: 518 Subject Start: 2232858 Subject End: 2232905 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 2232858 PA2041 +
Raw Sequence Start: 2232384 PA2041 +
Extrapolated Insert Location: 2232448 PA2041 +
Default Offset Location: 2232447 PA2041 +
H PA14 Blast Hit H PAO1 Blast Hit