Mutant Report for Mutant ID: 38758

Strain: PA14 Genetic Background: Wild Type Transposon: MrT7 Library: lib_04_04
Raw Sequence ID: 22519
Chromat Path: H:\Pa14\MrT7\404v1\404v1_F10_F10_089.ab1 Last Transposon Base: 63 Transposon Sequence
Match Quality: 0
Raw Sequence:
(Transposon Sequence in Red)
NGTTCAGTTAGTATACGACTACTATATGAGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTACGGAGT
GCTCGCGGTGCTCGCCCATACCCTCACATCACATCATCTGCAGGCCAGGCCATACGACNCCCGCCTGCTG
CGCCTGGGCCTCGCCCTGAAAGGATGCGGCCTGCTGCTGTTCGCCCTGATCGACTCGTCATTCTGGATGG
TCTGCGCGCTGCTGCCCTTCGCGCTCGGCAGCCTCGCCACCCCGGTCATGCAGGGGCTGCTCTCGGCCCG
CGTGCCGGACGATCGCCCAGGCCAGTTGCAGGGCGTGCTGAACAGCCTGATGAGCCTCGCCGCTATCGTC
CGTCCGCCGCTGATTAGCGGTCTTGTTCCTCTGGGGCAGCGGTCCGCTCGCGCCATTGCCCCTGGCCGGC
GCGCCATCCCTCGCCGGCCCCCCTTCTCGTCTGTTCCGGCTGGTCCCGGCCTGCCACCTTCGACTACCTT
CAGAATAACTATCATGAACCGGATAAACAGATCGTGCTTGATGGTGACTTTTAATCCTGACAACAACAAA
TTATAACCCTTGTTGAAACTGCTCCGTACTTCAAAAATGCGCATTCCTCGAAGACACAACATTACCGCCA
ACCTATCCAAAAAAAATGCCCAGTAGAGATGAAAAAAACACCCACCCACTAACTTCAAATAACAAAAGTC
ATTAACAAATTATAATATAAAGTATCCAAATTATATTTTCACAGCTGAAGAACAAAATTGCTTTCTTGTT
ATATCATGAACACAAGCCCCCACAGCTCCCTTCATCACCATCCATTATCCTACACCCAGAACCCATACCA
ATTAATTACCCACCCCACA
Blast against PA14
Processed Seqquence ID: 16716
5' Trim Position: 36 3' Trim Position: 275
Processed Sequence:
(Transposon Sequence in Red)
GACCGGGGACTTATCAGCCAACCTGTTACGGAGTGCTCGCGGTGCTCGCCCATACCCTCACATCACATCA
TCTGCAGGCCAGGCCATACGACNCCCGCCTGCTGCGCCTGGGCCTCGCCCTGAAAGGATGCGGCCTGCTG
CTGTTCGCCCTGATCGACTCGTCATTCTGGATGGTCTGCGCGCTGCTGCCCTTCGCGCTCGGCAGCCTCG
CCACCCCGGTCATGCAGGGGCTGCTCTCG
Blast against PA14
BLAST of Processed Sequence against PA14 And PAO1 Genome Sequence
75534 75534 75535 75535 75536 75536 75537 75537 75538 75538 75539 75539 75540 75540 75541 75541
PA14 BLAST Hit ID: 75534       Show Transposon Map
Identities: 146/152 (96.05%) BLAST Bit Score: 256.0 Percent of Processed Sequence That Aligns: 63.18%
Query Start: 88 Query End: 239 Subject Start: 4426480 Subject End: 4426631 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 4426480 PA14_49750 +
Raw Sequence Start: 4426357 PA14_49750 +
Extrapolated Insert Location: 4426420 PA14_49750 +
Default Offset Location: 4426420 PA14_49750 +
PA14 BLAST Hit ID: 75535       Show Transposon Map
Identities: 31/33 (93.93%) BLAST Bit Score: 50.1 Percent of Processed Sequence That Aligns: 13.39%
Query Start: 27 Query End: 59 Subject Start: 4426419 Subject End: 4426451 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 4426419 PA14_49750 +
Raw Sequence Start: 4426357 PA14_49750 +
Extrapolated Insert Location: 4426420 PA14_49750 +
Default Offset Location: 4426420 PA14_49750 +
PA14 BLAST Hit ID: 75536       Show Transposon Map
Identities: 26/28 (92.85%) BLAST Bit Score: 40.1 Percent of Processed Sequence That Aligns: 11.30%
Query Start: 131 Query End: 158 Subject Start: 3023560 Subject End: 3023533 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 3023560 PA14_33990 +
Raw Sequence Start: 3023726 PA14_33990 +
Extrapolated Insert Location: 3023663 PA14_33990 +
Default Offset Location: 3023663 PA14_33990 +
PA14 BLAST Hit ID: 75537       Show Transposon Map
Identities: 23/24 (95.83%) BLAST Bit Score: 40.1 Percent of Processed Sequence That Aligns: 9.62%
Query Start: 99 Query End: 122 Subject Start: 2164560 Subject End: 2164537 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 2164560 PA14_24740,PA14_24750* +,-
Raw Sequence Start: 2164694 PA14_24740,PA14_24750* +,-
Extrapolated Insert Location: 2164631 PA14_24740,PA14_24750* +,-
Default Offset Location: 2164631 PA14_24740,PA14_24750* +,-
PAO1 BLAST Hit ID: 75538       Show Transposon Map
Identities: 146/152 (96.05%) BLAST Bit Score: 256.0 Percent of Processed Sequence That Aligns: 63.18%
Query Start: 88 Query End: 239 Subject Start: 1223451 Subject End: 1223300 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 1223451 PA1131 +
Raw Sequence Start: 1223574 PA1131 +
Extrapolated Insert Location: 1223511 PA1131 +
Default Offset Location: 1223511 PA1131 +
PAO1 BLAST Hit ID: 75539       Show Transposon Map
Identities: 31/33 (93.93%) BLAST Bit Score: 50.1 Percent of Processed Sequence That Aligns: 13.39%
Query Start: 27 Query End: 59 Subject Start: 1223512 Subject End: 1223480 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 1223512 PA1131 +
Raw Sequence Start: 1223574 PA1131 +
Extrapolated Insert Location: 1223511 PA1131 +
Default Offset Location: 1223511 PA1131 +
PAO1 BLAST Hit ID: 75540       Show Transposon Map
Identities: 23/24 (95.83%) BLAST Bit Score: 40.1 Percent of Processed Sequence That Aligns: 9.62%
Query Start: 99 Query End: 122 Subject Start: 3404796 Subject End: 3404819 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 3404796 PA3042 +
Raw Sequence Start: 3404662 PA3042 +
Extrapolated Insert Location: 3404725 PA3042 +
Default Offset Location: 3404725 PA3042 +
PAO1 BLAST Hit ID: 75541       Show Transposon Map
Identities: 26/28 (92.85%) BLAST Bit Score: 40.1 Percent of Processed Sequence That Aligns: 11.30%
Query Start: 131 Query End: 158 Subject Start: 2621042 Subject End: 2621069 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 2621042 PA2371 +
Raw Sequence Start: 2620876 PA2371 +
Extrapolated Insert Location: 2620939 PA2371 +
Default Offset Location: 2620939 PA2371 +
H PA14 Blast Hit H PAO1 Blast Hit