Mutant Report for Mutant ID: 37724

Strain: PA14 Genetic Background: Wild Type Transposon: MrT7 Library: lib_04_04
Raw Sequence ID: 21485
Chromat Path: H:\Pa14\MrT7\393v1\393v1_H08_H8_074.ab1 Last Transposon Base: 63 Transposon Sequence
Match Quality: 0
Raw Sequence:
(Transposon Sequence in Red)
TGTTCAGTTTGTATACGACTCCTATAGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTACGACCG
CACCTACTACTGGCTGGGCTACGCCTTCGAGCGGCGGATCAACGATGTCTGGCAGTTCCGCCAGAACCTG
CGTTACCTGCGCAACGACCTGTCGTTCCAGGCGGTTACAGCGGGCACAGCTCATGCCGACGGCACACTGG
AACGCAGCACCACCTCGGTGGATGAAGACGTCAGTCAGTTCGTAGTAGATAACAACTTCCAGGCCGACTT
CGAAACAGGCGCCCTGCGCCACACCCTGCTGCTAGGCCTGGATCACAACCGCACCGACAATCAATACACA
TCAACTGCATCATCTGCAAGCCTGGCCAACGTCNACAACCCGATCTACGGCCAGCCGATCGTCAAACCGG
ATCGTTCGACGGCCTTCTACGACTACTAGCAGAAGACCTACCAGACCGGCCTCTACGTCCAGGACCAGAT
CGCCCTCGACAACTGGCGCCTGAACCTAGGAAGTCGCGAGGACTGGGTGCATCACGGGGCCCCCTTCTAC
AACAAGGGCGACGCCCCCAATACCTACCCCTAACATCATTCTGCCGGCTCTGGCCATTCATTTAACTTTT
CCATTTCTTACGCCCTTCCCCCTTCCCCACCTCCCCCCTACGTCTGTCCCTTTTCCTCCCACCCTCTCTC
TCTTATCTGGCTCCTATACATGTCTCTTCCCTGTCTCTTCCTCTCCGCCCGTGTTCGGCCCATATCGCTT
TTTGTTGGTGCTATTTTTCGTCTTTTTATTTTATATGTATCATTAAATACTCATGATTTATTATGGATAT
TTTTTTCCCCTCTCTTCCACACTTTCTTTATCTCTCTCTCACCT
Blast against PA14
Processed Seqquence ID: 15902
5' Trim Position: 4 3' Trim Position: 496
Processed Sequence:
(Transposon Sequence in Red)
CAGTTTGTATACGACTCCTATAGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTACGACCGCACC
TACTACTGGCTGGGCTACGCCTTCGAGCGGCGGATCAACGATGTCTGGCAGTTCCGCCAGAACCTGCGTT
ACCTGCGCAACGACCTGTCGTTCCAGGCGGTTACAGCGGGCACAGCTCATGCCGACGGCACACTGGAACG
CAGCACCACCTCGGTGGATGAAGACGTCAGTCAGTTCGTAGTAGATAACAACTTCCAGGCCGACTTCGAA
ACAGGCGCCCTGCGCCACACCCTGCTGCTAGGCCTGGATCACAACCGCACCGACAATCAATACACATCAA
CTGCATCATCTGCAAGCCTGGCCAACGTCNACAACCCGATCTACGGCCAGCCGATCGTCAAACCGGATCG
TTCGACGGCCTTCTACGACTACTAGCAGAAGACCTACCAGACCGGCCTCTACGTCCAGGACCAGATCGCC
CT
Blast against PA14
BLAST of Processed Sequence against PA14 And PAO1 Genome Sequence
71832 71832 71833 71833 71834 71834 71835 71835 71836 71836
PA14 BLAST Hit ID: 71832       Show Transposon Map
Identities: 292/292 (100.00%) BLAST Bit Score: 579.0 Percent of Processed Sequence That Aligns: 59.15%
Query Start: 59 Query End: 350 Subject Start: 544111 Subject End: 543820 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 544111 PA14_06160 +
Raw Sequence Start: 544173 PA14_06160 +
Extrapolated Insert Location: 544110 PA14_06160 +
Default Offset Location: 544110 PA14_06160 +
PA14 BLAST Hit ID: 71833       Show Transposon Map
Identities: 118/120 (98.33%) BLAST Bit Score: 224.0 Percent of Processed Sequence That Aligns: 24.19%
Query Start: 373 Query End: 492 Subject Start: 543797 Subject End: 543678 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 543797 PA14_06160 +
Raw Sequence Start: 544173 PA14_06160 +
Extrapolated Insert Location: 544110 PA14_06160 +
Default Offset Location: 544110 PA14_06160 +
PAO1 BLAST Hit ID: 71834       Show Transposon Map
Identities: 110/111 (99.09%) BLAST Bit Score: 212.0 Percent of Processed Sequence That Aligns: 22.36%
Query Start: 59 Query End: 169 Subject Start: 531312 Subject End: 531202 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 531312 PA0470 +
Raw Sequence Start: 531374 PA0470 +
Extrapolated Insert Location: 531311 PA0470 +
Default Offset Location: 531311 PA0470 +
PAO1 BLAST Hit ID: 71835       Show Transposon Map
Identities: 94/104 (90.38%) BLAST Bit Score: 127.0 Percent of Processed Sequence That Aligns: 20.93%
Query Start: 224 Query End: 327 Subject Start: 531135 Subject End: 531032 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 531135 PA0470 +
Raw Sequence Start: 531362 PA0470 +
Extrapolated Insert Location: 531299 PA0470 +
Default Offset Location: 531299 PA0470 +
PAO1 BLAST Hit ID: 71836       Show Transposon Map
Identities: 108/122 (88.52%) BLAST Bit Score: 117.0 Percent of Processed Sequence That Aligns: 24.39%
Query Start: 372 Query End: 492 Subject Start: 530984 Subject End: 530864 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 530984 PA0470 +
Raw Sequence Start: 531359 PA0470 +
Extrapolated Insert Location: 531296 PA0470 +
Default Offset Location: 531296 PA0470 +
H PA14 Blast Hit H PAO1 Blast Hit