Mutant Report for Mutant ID: 37711

Strain: PA14 Genetic Background: Wild Type Transposon: MrT7 Library: lib_04_04
Raw Sequence ID: 21472
Chromat Path: H:\Pa14\MrT7\393v1\393v1_G07_G7_054.ab1 Last Transposon Base: 65 Transposon Sequence
Match Quality: 0
Raw Sequence:
(Transposon Sequence in Red)
TGTTCAGTTTGTATACGACTCACTATAGGGTGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTACGTA
CTCGCCGAAGGCGCCCTCGACGATCGCGAGGTCAACCTCGGCTACGCCTTCAACGAAGGCGAGGCGGGCT
ACCAGCAGTCGTTCATCTCCGGATACCGGCGCAACTCCTCGTCTGGAGGCCTGGCCATCGCCGACCTGGC
ACCGGCCTGGCAGCAGAAGCTCTCCGCCAGCCTGCCGAAGCCCGCCGCCGGCACCCCGCTGAAGCCGATG
CTGTACTTCATCGGCAAGTACGAGGTGACCGCCCGCCAGTACGCCGCAGTGATGAGCCAGGCGGCCGCGC
TCTCCGGCCAGGGCGAAGCGCCGGCCTGCGACGTGCCGGGCGGGATGGCCGCGCGGCTGCCCAAGGTCGA
CCTCTCGCGCTTCGACGCCGAACGCTTCGGCGCGGTGTACAGCGCCTGGCTGCTGAAGAACCACCCGGAT
CTGCTGCCGGTCAGCGGCCGCGGCAAGAATCCCGAGGACGGCGGCATCGGTTTCGTCCCGCTGCCCACCG
AGGTCCAGTGGGAGTTCGCCGCGCGCGGCGGGCTAGCTGTCAGCCGCCTGGAACCGGAAGGGTCGGCTGT
TCCCGCGCAAGGCCCGAGGGCACCGACCAGGAAGGCCCCGCTGGGCTAACTGTGCGGTGTACAATCCAGG
TCTCCCAGGGAGGACACTGCCCATGCCTGCTATACTTGTGGCCTGTTTTGGTATTTAACAGGCGCGAACC
CCTTTGGCCCCGGTCCCAACCTGTGTCGGTAATGACGCGTGAAGAAGGGCCATAGAAGTCTTTCCCAACA
TTCTCACACCTATCTTATTTTGTAAGAATCAATAATCCCTCATTCCTTTATGAATAGCCCGAAAACTCTT
CCCT
Blast against PA14
Processed Seqquence ID: 15891
5' Trim Position: 30 3' Trim Position: 441
Processed Sequence:
(Transposon Sequence in Red)
TGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTACGTACTCGCCGAAGGCGCCCTCGACGATCGCGAG
GTCAACCTCGGCTACGCCTTCAACGAAGGCGAGGCGGGCTACCAGCAGTCGTTCATCTCCGGATACCGGC
GCAACTCCTCGTCTGGAGGCCTGGCCATCGCCGACCTGGCACCGGCCTGGCAGCAGAAGCTCTCCGCCAG
CCTGCCGAAGCCCGCCGCCGGCACCCCGCTGAAGCCGATGCTGTACTTCATCGGCAAGTACGAGGTGACC
GCCCGCCAGTACGCCGCAGTGATGAGCCAGGCGGCCGCGCTCTCCGGCCAGGGCGAAGCGCCGGCCTGCG
ACGTGCCGGGCGGGATGGCCGCGCGGCTGCCCAAGGTCGACCTCTCGCGCTTCGACGCCGA
Blast against PA14
BLAST of Processed Sequence against PA14 And PAO1 Genome Sequence
71789 71789 71790 71790 71791 71791 71792 71792
PA14 BLAST Hit ID: 71789       Show Transposon Map
Identities: 244/244 (100.00%) BLAST Bit Score: 484.0 Percent of Processed Sequence That Aligns: 59.12%
Query Start: 168 Query End: 411 Subject Start: 82445 Subject End: 82202 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 82445 PA14_00830 +
Raw Sequence Start: 82642 PA14_00830,PA14_00840* +,+
Extrapolated Insert Location: 82577 PA14_00830,PA14_00840* +,+
Default Offset Location: 82579 PA14_00830,PA14_00840* +,+
PA14 BLAST Hit ID: 71790       Show Transposon Map
Identities: 107/108 (99.07%) BLAST Bit Score: 206.0 Percent of Processed Sequence That Aligns: 26.03%
Query Start: 35 Query End: 142 Subject Start: 82578 Subject End: 82471 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 82578 PA14_00830,PA14_00840* +,+
Raw Sequence Start: 82642 PA14_00830,PA14_00840* +,+
Extrapolated Insert Location: 82577 PA14_00830,PA14_00840* +,+
Default Offset Location: 82579 PA14_00830,PA14_00840* +,+
PAO1 BLAST Hit ID: 71791       Show Transposon Map
Identities: 238/244 (97.54%) BLAST Bit Score: 436.0 Percent of Processed Sequence That Aligns: 59.12%
Query Start: 168 Query End: 411 Subject Start: 84800 Subject End: 84557 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 84800 PA0071 +
Raw Sequence Start: 84997 PA0071 +
Extrapolated Insert Location: 84932 PA0071 +
Default Offset Location: 84934 PA0071 +
PAO1 BLAST Hit ID: 71792       Show Transposon Map
Identities: 107/108 (99.07%) BLAST Bit Score: 206.0 Percent of Processed Sequence That Aligns: 26.03%
Query Start: 35 Query End: 142 Subject Start: 84933 Subject End: 84826 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 84933 PA0071 +
Raw Sequence Start: 84997 PA0071 +
Extrapolated Insert Location: 84932 PA0071 +
Default Offset Location: 84934 PA0071 +
H PA14 Blast Hit H PAO1 Blast Hit