Mutant Report for Mutant ID: 37604

Strain: PA14 Genetic Background: Wild Type Transposon: MrT7 Library: lib_04_04
Raw Sequence ID: 21365
Chromat Path: H:\Pa14\MrT7\392v1\392v1_F08_F8_073.ab1 Last Transposon Base: Transposon Sequence
Match Quality:
Raw Sequence:
(Transposon Sequence in Red)
CGCCAACCTGTTACTTCAAGGGTGAATCCAAGGAGGCCCAGGCGCAGGCGCTGGAAGCCGACCTCGAGAA
GATCCGGGCGAAGAACGGCGCGGTGCCGCCGGGCTACCACGCCCAGCTGGGGCTGCTCTATTCCAGCATC
GGCAAGGACGACCAGATGGTCCGCGAGTTCGAGACCGAGAAGGCGCTGTTTCCCGAGTCGGCGACCTACA
TGGACTTCCTCCTGAACAACGCCCGTGGAGGTGCCCGTTGAAACTCGCCCGACTATCCGGCCTGGTGGCC
GGTTTCACCCTGCTGGCCCTGCTCGGCGGCTGCGCGCCGACCAAGAGCGTCGACTACTCGGCGTTCAAGC
AGGCCAAGCCGCGCTCGATCCTGGTCCTGCCGCCGCTGAACGAGTCGCCCGACGTGAAGGCGACCTACAG
CATGCTCTCGCAAGTCATCTTCTGGAGGGCTGGAGACGGGTTAATACTTGGTGGCTGGTGGAGCCGGGAG
TACAAGACCTTCCCGCCAGATAGGGTCTGAAACAGCGCTCAGCTAACGTGCACCAATGTGTCCACCGGGT
CTACCTGCTCGGAGAATCTATGGGGGACCAACGCCGGGGCGTGTACAGTCACCGGGGGAGCGGACTTACG
GTCACCTCGGCCTTACTGGGCTGTTCCCAGTATGGCGCACACCTTTTGGTCTCCGTCCAGGCGCCAAAAA
CTGGTTCAGACTGGCAGAATCCGGCAACTCACCCTGGTGGATCTGGGGTTAGGTGAACCGACCTCTTCTC
GGAGGTAACGGGACTGTCGTGCATACAACCATTCTACCTGAGTAGTGACACTACTAACACCTCACGGGGG
TCCAGGTGAAGGTTCGTCACAAGTTAGGTGGTAGGATATCCTTTTTTACTTAACTCCAGGATTAAC
Blast against PA14
Processed Seqquence ID: 15797
5' Trim Position: 1 3' Trim Position: 428
Processed Sequence:
(Transposon Sequence in Red)
GCCAACCTGTTACTTCAAGGGTGAATCCAAGGAGGCCCAGGCGCAGGCGCTGGAAGCCGACCTCGAGAAG
ATCCGGGCGAAGAACGGCGCGGTGCCGCCGGGCTACCACGCCCAGCTGGGGCTGCTCTATTCCAGCATCG
GCAAGGACGACCAGATGGTCCGCGAGTTCGAGACCGAGAAGGCGCTGTTTCCCGAGTCGGCGACCTACAT
GGACTTCCTCCTGAACAACGCCCGTGGAGGTGCCCGTTGAAACTCGCCCGACTATCCGGCCTGGTGGCCG
GTTTCACCCTGCTGGCCCTGCTCGGCGGCTGCGCGCCGACCAAGAGCGTCGACTACTCGGCGTTCAAGCA
GGCCAAGCCGCGCTCGATCCTGGTCCTGCCGCCGCTGAACGAGTCGCCCGACGTGAAGGCGACCTACAGC
ATGCTCT
Blast against PA14
BLAST of Processed Sequence against PA14 And PAO1 Genome Sequence
71396 71396 71397 71397 71398 71398 71399 71399 71400 71400 71401 71401 71402 71402
PA14 BLAST Hit ID: 71396       Show Transposon Map
Identities: 417/417 (100.00%) BLAST Bit Score: 827.0 Percent of Processed Sequence That Aligns: 97.42%
Query Start: 11 Query End: 427 Subject Start: 59849 Subject End: 60265 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 59849 PA14_00580 +
Raw Sequence Start: 59838 PA14_00580 +
Extrapolated Insert Location:
Default Offset Location: 59901 PA14_00580 +
PA14 BLAST Hit ID: 71397       Show Transposon Map
Identities: 21/21 (100.00%) BLAST Bit Score: 42.1 Percent of Processed Sequence That Aligns: 4.68%
Query Start: 289 Query End: 309 Subject Start: 6264924 Subject End: 6264944 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 6264924 PA14_70270,PA14_70250* +,-
Raw Sequence Start: 6264635 PA14_70270,PA14_70250* +,-
Extrapolated Insert Location:
Default Offset Location: 6264698 PA14_70270,PA14_70250* +,-
PA14 BLAST Hit ID: 71398       Show Transposon Map
Identities: 21/21 (100.00%) BLAST Bit Score: 42.1 Percent of Processed Sequence That Aligns: 4.68%
Query Start: 151 Query End: 171 Subject Start: 849554 Subject End: 849574 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 849554 PA14_09890 +
Raw Sequence Start: 849403 PA14_09890 +
Extrapolated Insert Location:
Default Offset Location: 849466 PA14_09890 +
PA14 BLAST Hit ID: 71399       Show Transposon Map
Identities: 23/24 (95.83%) BLAST Bit Score: 40.1 Percent of Processed Sequence That Aligns: 5.39%
Query Start: 291 Query End: 314 Subject Start: 5508749 Subject End: 5508772 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 5508749 PA14_61740 +
Raw Sequence Start: 5508458 PA14_61720,PA14_61730* +,-
Extrapolated Insert Location:
Default Offset Location: 5508521 PA14_61720,PA14_61730* +,-
PAO1 BLAST Hit ID: 71400       Show Transposon Map
Identities: 414/417 (99.28%) BLAST Bit Score: 803.0 Percent of Processed Sequence That Aligns: 97.42%
Query Start: 11 Query End: 427 Subject Start: 61487 Subject End: 61903 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 61487 PA0046 +
Raw Sequence Start: 61476 PA0046 +
Extrapolated Insert Location:
Default Offset Location: 61539 PA0046 +
PAO1 BLAST Hit ID: 71401       Show Transposon Map
Identities: 21/21 (100.00%) BLAST Bit Score: 42.1 Percent of Processed Sequence That Aligns: 4.68%
Query Start: 151 Query End: 171 Subject Start: 4673154 Subject End: 4673134 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 4673154 PA4176 +
Raw Sequence Start: 4673305 PA4176 +
Extrapolated Insert Location:
Default Offset Location: 4673242 PA4176 +
PAO1 BLAST Hit ID: 71402       Show Transposon Map
Identities: 23/24 (95.83%) BLAST Bit Score: 40.1 Percent of Processed Sequence That Aligns: 5.39%
Query Start: 291 Query End: 314 Subject Start: 5236805 Subject End: 5236828 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 5236805 PA4668 +
Raw Sequence Start: 5236514 PA4667 +
Extrapolated Insert Location:
Default Offset Location: 5236577 PA4667 +
H PA14 Blast Hit H PAO1 Blast Hit