Mutant Report for Mutant ID: 36912

Strain: PA14 Genetic Background: Wild Type Transposon: MrT7 Library: lib_04_04
Raw Sequence ID: 20673
Chromat Path: H:\Pa14\MrT7\385v1\385v1_D12_D12_096.ab1 Last Transposon Base: 63 Transposon Sequence
Match Quality: 1
Raw Sequence:
(Transposon Sequence in Red)
TGTCGTTTGTATACGACTCAGTATAGGGTGTCTAGAGACCGGAGACTTATCAGCCAACCTGTTAGGGATG
CTCGCCATAGAGGCGCTTGAACAGCTCCAGCCCGGCCAGCTTGCCGGGGTTCTGCTTCTGGTACTCGAAA
CCGGCCAGGACCTGGTTCTTGATGAGTGCCAGGGCGTCCTCGGGGAAGGTCGGCTGGCCGATCACCTGTT
CGAACAGCTTCAGCGCCTGGGTCCGCTTGTCGGCGTCGGACAGGCTGCGCAGGCCGGCCACCGCCATGTC
GCGGTAGGAACCGTTGCTGAACGAGGCGCCGAGGTCCTCGAAGCCGGCGGCGATGGCAGTGGTGTCCTTG
CCTGGCACGCCTTCGTTGAGCATGGCGTTGGTCATCATCTGCAGGCCGGGGCAGCAGGCGTCCTGGCTGC
TGCCGGCGGCGAAGGACAGGCGCATGTCGAACATCGGCAGTTCATGGGCTTCGACGAACAGCACCTTGGC
ACCTTCGGCGGTCTTCCATTCCTGGATGTCCAGCTTGCGATGGACCGGCGTCTGCTTGGCGAACTCCTTC
AACGACTGCAACTGGTTTTCCTCGACCGCCGCGTCATGGACCGTCGCCGGGGTCTGGGTGGGACCCGCGA
ACAAATAGGCCAGCGTCGGCAACAATGCAATGACTATCAGGCCGAGCAGGCCCTAACGCACCCCATGTGC
GCTCACTCATGTACGGTCCCCCTTTTTCCTCGGTCTTTCCAAGGCGCTATTTGCGTCAAGGGTCTTAGCC
CAACGTGGTGAAATAACGTGCGGGCCGATTTTCCTGTAAACGGCCCTGATGCTCTGACTTTTAGGCGCCG
GCTCAGCGTCGGCGTGAATTATCCTT
Blast against PA14
Processed Seqquence ID: 15280
5' Trim Position: 38 3' Trim Position: 433
Processed Sequence:
(Transposon Sequence in Red)
CCGGAGACTTATCAGCCAACCTGTTAGGGATGCTCGCCATAGAGGCGCTTGAACAGCTCCAGCCCGGCCA
GCTTGCCGGGGTTCTGCTTCTGGTACTCGAAACCGGCCAGGACCTGGTTCTTGATGAGTGCCAGGGCGTC
CTCGGGGAAGGTCGGCTGGCCGATCACCTGTTCGAACAGCTTCAGCGCCTGGGTCCGCTTGTCGGCGTCG
GACAGGCTGCGCAGGCCGGCCACCGCCATGTCGCGGTAGGAACCGTTGCTGAACGAGGCGCCGAGGTCCT
CGAAGCCGGCGGCGATGGCAGTGGTGTCCTTGCCTGGCACGCCTTCGTTGAGCATGGCGTTGGTCATCAT
CTGCAGGCCGGGGCAGCAGGCGTCCTGGCTGCTGCCGGCGGCGAA
Blast against PA14
BLAST of Processed Sequence against PA14 And PAO1 Genome Sequence
69282 69282 69283 69283
PA14 BLAST Hit ID: 69282       Show Transposon Map
Identities: 364/371 (98.11%) BLAST Bit Score: 680.0 Percent of Processed Sequence That Aligns: 93.67%
Query Start: 25 Query End: 395 Subject Start: 430118 Subject End: 430488 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 430118 PA14_04870,PA14_04880* -,+
Raw Sequence Start: 430056 PA14_04870,PA14_04880* -,+
Extrapolated Insert Location: 430119 PA14_04870,PA14_04880* -,+
Default Offset Location: 430119 PA14_04870,PA14_04880* -,+
PAO1 BLAST Hit ID: 69283       Show Transposon Map
Identities: 359/371 (96.76%) BLAST Bit Score: 640.0 Percent of Processed Sequence That Aligns: 93.67%
Query Start: 25 Query End: 395 Subject Start: 415370 Subject End: 415740 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 415370 PA0371 -
Raw Sequence Start: 415308 PA0371 -
Extrapolated Insert Location: 415371 PA0371 -
Default Offset Location: 415371 PA0371 -
H PA14 Blast Hit H PAO1 Blast Hit