Mutant Report for Mutant ID: 36452

Strain: PA14 Genetic Background: Wild Type Transposon: MrT7 Library: lib_04_04
Raw Sequence ID: 20213
Chromat Path: H:\Pa14\MrT7\380v1\380v1_F08_F8_073.ab1 Last Transposon Base: 63 Transposon Sequence
Match Quality: 0
Raw Sequence:
(Transposon Sequence in Red)
TGTTCAGTTTGTATACGACTCCTATAGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTAGGCGCC
CTGGTCCCAGCGCGCTTCCAGGCGAAAGCCGAGAAGATCGCGGTAGAAGGCGATGCTGGCCGGCAGATCG
GCGACCGCCAGGGTCAGGTGATTGAGACCGGTAAGCATGGGGGCTCCTTGCAAGGTGTGGCGAGAGGTCG
ATTCAGGCACGTCCCAGCCAGTCGCCGCGGATCATTTCCATCAGTTGGCGCAAGCCGGGTTGCGGCTGGC
GTCGGCTCGGATAGTAGAGGCAGAACGGCGCGCCCATCGAGGTCCAGTCCGGCAATACCAGTTGCAGCCG
GCCGCTACGCAGCTCCTCGGCGATTCCCACCTCCAGGCAGTAGGCCAGGCCGACACCGTCCAGGGCCGCG
GCAACCGCCGTATTGCTTTCGTTGACGCTGAAGGGGCCGGGCACGTCGACCTCGACCATCCGCTCGCCGT
CGCCCAGTTCCCATTTGTAGAACGAGTTGTCGCCCAGGCGCATGCGGATGCAGGCGTGCCGCAACAGGTC
GTCCGGCCGCTGGGGCACGCCGTGGCGCGCCAGGTAATCGGGCGACGCGGCCACCACCCAGCGCAGCTCC
CCGGTCAATGGCACCGCGACCATGTCCTGGGGCACCGTGCCGCCGTAACGGATGCCGGCGTCGTAGCCGT
CGGCGACGATGTCGACCATGCGGTCCCTCACCGAAAGTTCCAGTTGCAGGTCCGGATACGCCTCGGTGCA
CACTGGGGGGGCCCGGGCCAAAAANTNNCTCGTAAGAATCGTGGGGGAAACGTTAAGGCCATCCCGGCCC
ACCGGCAAGTGGGAATAGT
Blast against PA14
Processed Seqquence ID: 14926
5' Trim Position: 5 3' Trim Position: 659
Processed Sequence:
(Transposon Sequence in Red)
AGTTTGTATACGACTCCTATAGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTAGGCGCCCTGGT
CCCAGCGCGCTTCCAGGCGAAAGCCGAGAAGATCGCGGTAGAAGGCGATGCTGGCCGGCAGATCGGCGAC
CGCCAGGGTCAGGTGATTGAGACCGGTAAGCATGGGGGCTCCTTGCAAGGTGTGGCGAGAGGTCGATTCA
GGCACGTCCCAGCCAGTCGCCGCGGATCATTTCCATCAGTTGGCGCAAGCCGGGTTGCGGCTGGCGTCGG
CTCGGATAGTAGAGGCAGAACGGCGCGCCCATCGAGGTCCAGTCCGGCAATACCAGTTGCAGCCGGCCGC
TACGCAGCTCCTCGGCGATTCCCACCTCCAGGCAGTAGGCCAGGCCGACACCGTCCAGGGCCGCGGCAAC
CGCCGTATTGCTTTCGTTGACGCTGAAGGGGCCGGGCACGTCGACCTCGACCATCCGCTCGCCGTCGCCC
AGTTCCCATTTGTAGAACGAGTTGTCGCCCAGGCGCATGCGGATGCAGGCGTGCCGCAACAGGTCGTCCG
GCCGCTGGGGCACGCCGTGGCGCGCCAGGTAATCGGGCGACGCGGCCACCACCCAGCGCAGCTCCCCGGT
CAATGGCACCGCGACCATGTCCTG
Blast against PA14
BLAST of Processed Sequence against PA14 And PAO1 Genome Sequence
67659 67659 67660 67660 67661 67661
PA14 BLAST Hit ID: 67659       Show Transposon Map
Identities: 597/597 (100.00%) BLAST Bit Score: 999.9 Percent of Processed Sequence That Aligns: 91.13%
Query Start: 58 Query End: 654 Subject Start: 4428125 Subject End: 4428721 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 4428125 PA14_49780,PA14_49770* -,+
Raw Sequence Start: 4428063 PA14_49780,PA14_49770* -,+
Extrapolated Insert Location: 4428126 PA14_49780,PA14_49770* -,+
Default Offset Location: 4428126 PA14_49780,PA14_49770* -,+
PA14 BLAST Hit ID: 67660       Show Transposon Map
Identities: 23/24 (95.83%) BLAST Bit Score: 40.1 Percent of Processed Sequence That Aligns: 3.52%
Query Start: 390 Query End: 413 Subject Start: 1083055 Subject End: 1083032 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 1083055 PA14_12630 -
Raw Sequence Start: 1083449 PA14_12630 -
Extrapolated Insert Location: 1083386 PA14_12630 -
Default Offset Location: 1083386 PA14_12630 -
PAO1 BLAST Hit ID: 67661       Show Transposon Map
Identities: 594/597 (99.49%) BLAST Bit Score: 999.9 Percent of Processed Sequence That Aligns: 91.13%
Query Start: 58 Query End: 654 Subject Start: 1221806 Subject End: 1221210 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 1221806 PA1129 -
Raw Sequence Start: 1221868 PA1129 -
Extrapolated Insert Location: 1221805 PA1129 -
Default Offset Location: 1221805 PA1129 -
H PA14 Blast Hit H PAO1 Blast Hit