Mutant Report for Mutant ID: 35940

Strain: PA14 Genetic Background: Wild Type Transposon: MrT7 Library: lib_04_04
Raw Sequence ID: 19701
Chromat Path: H:\Pa14\MrT7\375v1\375v1_C12_C12_098.ab1 Last Transposon Base: 24 Transposon Sequence
Match Quality: 3
Raw Sequence:
(Transposon Sequence in Red)
CGGGAACTTATCAGCCAACCTGTTACGTAGTCGGTGGCCGGGCGTCACCAGGCGCCAACGACGCGGCGAC
CCTGGAACACGTCGAGGAAGCGGTGGCGCGCCTGCGCCGGCATACCGACTTGCCGATCGGTATCGGCTTC
GGCATCCGCAGCGCCGAACACGCCGCCGCGGTCTCGCGCGGTTGGCCGACGGCGTGGTGGTCGGCTCGGC
GCTGATCGACCGGATCGCCAAGGCCCGCGACAATGCCCAGGCGGTCAAGGATGTCCTCGCCCTGTGCGGC
GAGCTGGCCGAAAGCGTGCGCAACGCACGCTGACAGACCCTGACAGCGGCATTCGCCAGGCGCAGGCAAC
CCGCTGCGCCTGGCCTTGCGTTGCACGCTGCCAGAACCGTGAGGAAAAATTCACGGTCACTTTCCTAAAC
GTCTTATTGTCCCGCCGACTCTGCCGAAGCCTTGAATAGCGCCTCACCCAAATAGCCAACGCATTCTAAG
AAGGTTCGCCCGGATAAGGGGGTGATCGTCGATGATCATTCCGCTATCCGCCCTGGCGTGCGCTTGGTTG
TTTGAATCCCCACGGTTTCACCACCGTCTGGGAGGGCGACCACCGTGCCCAAGCCCCTGCGGGTACCCCG
CAGAAAGCTCCCTACCCGGGCCTTCTGGGCATCCGGATCCCCACAATCCCCGGGCTCCAAATGGTTTCCC
CCCTCTAATTCCTCAAGCTTGGCCCCCAAGGCCTGGGCCTGACCCCGCGAAAACCCGGGGGTGTTCCCCC
GCCTCCTCTTTCCGCCCGGGTCCCATTGGTGGTGCTTGCCAATGAGAAATCTTCGCCCTATG
Blast against PA14
Processed Seqquence ID: 14432
5' Trim Position: 20 3' Trim Position: 454
Processed Sequence:
(Transposon Sequence in Red)
TGTTACGTAGTCGGTGGCCGGGCGTCACCAGGCGCCAACGACGCGGCGACCCTGGAACACGTCGAGGAAG
CGGTGGCGCGCCTGCGCCGGCATACCGACTTGCCGATCGGTATCGGCTTCGGCATCCGCAGCGCCGAACA
CGCCGCCGCGGTCTCGCGCGGTTGGCCGACGGCGTGGTGGTCGGCTCGGCGCTGATCGACCGGATCGCCA
AGGCCCGCGACAATGCCCAGGCGGTCAAGGATGTCCTCGCCCTGTGCGGCGAGCTGGCCGAAAGCGTGCG
CAACGCACGCTGACAGACCCTGACAGCGGCATTCGCCAGGCGCAGGCAACCCGCTGCGCCTGGCCTTGCG
TTGCACGCTGCCAGAACCGTGAGGAAAAATTCACGGTCACTTTCCTAAACGTCTTATTGTCCCGCCGACT
CTGCCGAAGCCTTG
Blast against PA14
BLAST of Processed Sequence against PA14 And PAO1 Genome Sequence
64860 64860 64861 64861 64862 64862 64863 64863
PA14 BLAST Hit ID: 64860       Show Transposon Map
Identities: 414/425 (97.41%) BLAST Bit Score: 722.0 Percent of Processed Sequence That Aligns: 97.70%
Query Start: 10 Query End: 434 Subject Start: 37384 Subject End: 36968 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 37384 PA14_00440 +
Raw Sequence Start: 37413 PA14_00440 +
Extrapolated Insert Location: 37389 PA14_00440 +
Default Offset Location: 37350 PA14_00440 +
PA14 BLAST Hit ID: 64861       Show Transposon Map
Identities: 30/32 (93.75%) BLAST Bit Score: 48.1 Percent of Processed Sequence That Aligns: 7.14%
Query Start: 170 Query End: 201 Subject Start: 524710 Subject End: 524679 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 524710 PA14_05920 +
Raw Sequence Start: 524899 PA14_05920 +
Extrapolated Insert Location: 524875 PA14_05920 +
Default Offset Location: 524836 PA14_05920 +
PAO1 BLAST Hit ID: 64862       Show Transposon Map
Identities: 413/425 (97.17%) BLAST Bit Score: 714.0 Percent of Processed Sequence That Aligns: 97.70%
Query Start: 10 Query End: 434 Subject Start: 37363 Subject End: 36947 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 37363 PA0035 +
Raw Sequence Start: 37392 PA0035 +
Extrapolated Insert Location: 37368 PA0035 +
Default Offset Location: 37329 PA0035 +
PAO1 BLAST Hit ID: 64863       Show Transposon Map
Identities: 29/32 (90.62%) BLAST Bit Score: 40.1 Percent of Processed Sequence That Aligns: 7.14%
Query Start: 170 Query End: 201 Subject Start: 511432 Subject End: 511401 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 511432 PA0454 +
Raw Sequence Start: 511621 PA0454 +
Extrapolated Insert Location: 511597 PA0454 +
Default Offset Location: 511558 PA0454 +
H PA14 Blast Hit H PAO1 Blast Hit