Mutant Report for Mutant ID: 35865

Strain: PA14 Genetic Background: Wild Type Transposon: MrT7 Library: lib_04_04
Raw Sequence ID: 19626
Chromat Path: H:\Pa14\MrT7\374v1\374v1_E09_E9_069.ab1 Last Transposon Base: 62 Transposon Sequence
Match Quality: 0
Raw Sequence:
(Transposon Sequence in Red)
TGTCAGTTTGTATACGACTCCTATAGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTATCTGCAG
GGGTTGTTGGAAGAGCTGCGCTGATCACCCCGTCAGCGCTTTGACCCGACGGGCCCGGACGACTTGGGGC
CCGTCGTTTTTTTTGCCGACGCGCAGCGCGCTCAGCGCGCCGCCCAGGCATTGAAACGCTGTTCCAGCTC
CTCGCCGTGGTCCACCCAGAACTCGGCATCCACCGCCCGCGCGCCTTCGAGGTTGGCCGGCACGGTCGGC
AGCGCCTCCTGCACCGTCTTCGGCAGCAACGCCAGGGTGCCCTTGTGTACCGGCCCGTAGGGGATCTGCT
CGGAGAACACCTTCTGCGTCTGCGGCTGGCTGACGAAGGCGATGAATTTCTCCGCCAGCGCCTTGTTCGG
CGTGCCCTTCACTACCGCCCAATACTCCGGATCGTCATCATCGGCAGGCCTGACCATGGCCAGTTTCACC
CCCTCCTTCTGCGCANCGGCGATGCGCCCGTTGAAGGCCGCGCTCATCACCACGACGCCAGCCAACTACC
TTGCGGCGGCTGGGCGCCGGGCTACCAACAATGGAAGTTCAGTTAGAACTAATAAAGCTTGAAAAAGCAA
GGTTGACTCCCTCCGGGGGGGTAAGATCCTTTAAAAGGACTTCCGCCTTCACACCGTCGGCCAGCAGCCG
CACTCTCCGAGGTTACTTTTGCGCACGACCTCATATAGACGACCTAGGCAATGAACTAAACCACAGTTTT
ATACATACCATTTAATCTATAAATATTCTATAAATAAAAACAATTATCTATACAACTCAAACCTAAATTA
AATTATTTAAAAAATTAAATTGTAA
Blast against PA14
Processed Seqquence ID: 14362
5' Trim Position: 5 3' Trim Position: 458
Processed Sequence:
(Transposon Sequence in Red)
GTTTGTATACGACTCCTATAGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTATCTGCAGGGGTT
GTTGGAAGAGCTGCGCTGATCACCCCGTCAGCGCTTTGACCCGACGGGCCCGGACGACTTGGGGCCCGTC
GTTTTTTTTGCCGACGCGCAGCGCGCTCAGCGCGCCGCCCAGGCATTGAAACGCTGTTCCAGCTCCTCGC
CGTGGTCCACCCAGAACTCGGCATCCACCGCCCGCGCGCCTTCGAGGTTGGCCGGCACGGTCGGCAGCGC
CTCCTGCACCGTCTTCGGCAGCAACGCCAGGGTGCCCTTGTGTACCGGCCCGTAGGGGATCTGCTCGGAG
AACACCTTCTGCGTCTGCGGCTGGCTGACGAAGGCGATGAATTTCTCCGCCAGCGCCTTGTTCGGCGTGC
CCTTCACTACCGCCCAATACTCCGGATCGTCAT
Blast against PA14
BLAST of Processed Sequence against PA14 And PAO1 Genome Sequence
64554 64554 64555 64555 64556 64556 64557 64557 64558 64558 64559 64559 64560 64560 64561 64561
PA14 BLAST Hit ID: 64554       Show Transposon Map
Identities: 384/394 (97.46%) BLAST Bit Score: 718.0 Percent of Processed Sequence That Aligns: 86.75%
Query Start: 57 Query End: 450 Subject Start: 243096 Subject End: 242703 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 243096 PA14_02730 +
Raw Sequence Start: 243157 PA14_02730 +
Extrapolated Insert Location: 243095 PA14_02730 +
Default Offset Location: 243094 PA14_02730 +
PA14 BLAST Hit ID: 64555       Show Transposon Map
Identities: 43/50 (86.00%) BLAST Bit Score: 44.1 Percent of Processed Sequence That Aligns: 10.82%
Query Start: 177 Query End: 226 Subject Start: 5871291 Subject End: 5871340 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 5871291 PA14_65890*,PA14_65920,PA14_65910* +,-,+
Raw Sequence Start: 5871110 PA14_65900,PA14_65890*,PA14_65910* -,+,+
Extrapolated Insert Location: 5871172 PA14_65900,PA14_65890*,PA14_65910* -,+,+
Default Offset Location: 5871173 PA14_65900,PA14_65890*,PA14_65910* -,+,+
PA14 BLAST Hit ID: 64556       Show Transposon Map
Identities: 27/29 (93.10%) BLAST Bit Score: 42.1 Percent of Processed Sequence That Aligns: 6.18%
Query Start: 174 Query End: 202 Subject Start: 679808 Subject End: 679780 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 679808 PA14_07870 -
Raw Sequence Start: 679986 PA14_07880*,PA14_07890 +,-
Extrapolated Insert Location: 679924 PA14_07880* +
Default Offset Location: 679923 PA14_07880* +
PA14 BLAST Hit ID: 64557       Show Transposon Map
Identities: 20/20 (100.00%) BLAST Bit Score: 40.1 Percent of Processed Sequence That Aligns: 4.19%
Query Start: 196 Query End: 215 Subject Start: 103879 Subject End: 103860 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 103879 PA14_01070 -
Raw Sequence Start: 104079 PA14_01070 -
Extrapolated Insert Location: 104017 PA14_01070 -
Default Offset Location: 104016 PA14_01070 -
PAO1 BLAST Hit ID: 64558       Show Transposon Map
Identities: 381/394 (96.70%) BLAST Bit Score: 694.0 Percent of Processed Sequence That Aligns: 86.75%
Query Start: 57 Query End: 450 Subject Start: 252945 Subject End: 252552 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 252945 PA0223 +
Raw Sequence Start: 253006 PA0223 +
Extrapolated Insert Location: 252944 PA0223 +
Default Offset Location: 252943 PA0223 +
PAO1 BLAST Hit ID: 64559       Show Transposon Map
Identities: 44/50 (88.00%) BLAST Bit Score: 52.0 Percent of Processed Sequence That Aligns: 10.82%
Query Start: 177 Query End: 226 Subject Start: 5599893 Subject End: 5599942 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 5599893 PA4985 -
Raw Sequence Start: 5599712 PA4984 -
Extrapolated Insert Location: 5599774 PA4984 -
Default Offset Location: 5599775 PA4984 -
PAO1 BLAST Hit ID: 64560       Show Transposon Map
Identities: 27/29 (93.10%) BLAST Bit Score: 42.1 Percent of Processed Sequence That Aligns: 6.18%
Query Start: 174 Query End: 202 Subject Start: 666987 Subject End: 666959 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 666987 PA0604 -
Raw Sequence Start: 667165 PA0605 -
Extrapolated Insert Location: 667103
Default Offset Location: 667102
PAO1 BLAST Hit ID: 64561       Show Transposon Map
Identities: 20/20 (100.00%) BLAST Bit Score: 40.1 Percent of Processed Sequence That Aligns: 4.19%
Query Start: 196 Query End: 215 Subject Start: 106226 Subject End: 106207 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 106226 PA0088 -
Raw Sequence Start: 106426 PA0088 -
Extrapolated Insert Location: 106364 PA0088 -
Default Offset Location: 106363 PA0088 -
H PA14 Blast Hit H PAO1 Blast Hit