Mutant Report for Mutant ID: 35863

Strain: PA14 Genetic Background: Wild Type Transposon: MrT7 Library: lib_04_04
Raw Sequence ID: 19624
Chromat Path: H:\Pa14\MrT7\374v1\374v1_E07_E7_053.ab1 Last Transposon Base: 62 Transposon Sequence
Match Quality: 0
Raw Sequence:
(Transposon Sequence in Red)
GTTCAGTTTGTATACGACTCCTATAGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTACGTCGCT
CTGGAATGGGTGAAAGGCGAGATCGCCGAAACCCTGAAACAGGCGCGCCAGGCGCTGGAAGCGTTCGTCG
AGAACCCGCAGGACCCGACCCGCATGCGGTTCTGCCTGACCTACGTGCACCAGGTGCAGGGCACCCTGCA
GATGGTCGAGTTCTACGGCGCGGCCCTGCTCGCCGAGGAAATGGAGCAGTTGGTCCAGGCCTTGCTGGAC
GGTCGCGTGCCGAACCAGAGCGAGGCCCTGGAAGTGCTGATGCAGGCGATCCTGCAACTGCCGGTCTACC
TCGACCGGATCCAGACCGCCCGGCGCGACCTGCCGATGGTGGTCCTGCCGCTGCTCAACGACCTGCGCGC
CGCGCGCGGCGAGAAGCTGCTCTCGGAAAACCAGCCTGTTCGCGCCCGACCTGTCGCAGCGCCAGCCGCA
ATTGGACGGCGAGGCCATCGCGCAACTGCGCACCGACGAACTCGGGGGCTTGCTGCGCAAGCTGCGCCAG
ACCCAGCAGATGGCCCTGGTCGGCCTGCTGCGCACCAGGACGTGCCCACCACCCCGGCTTCCTGGGGCGG
TCTATGCCCGCCTGGAGGGCCTGTGCCGCAAGAACCGCTTGGGCCCTTTGTGGACATCCCTTTCCGGCCT
GGGCGAAGGCCTGGGCCAAACGGTTCGGGGTCCAAAAGGCCCTTCGGGGGCAACCCGGTTGGCCCCGCTT
CACCGGTAAATTCAAGGCCCCGGGTCAAAAAGGGGCCCCAAACGCCTTAACCAAGGCCCGCCCGAAAAAT
TTGTAAAAAAACTGGTTTTTCTCCTG
Blast against PA14
Processed Seqquence ID: 14360
5' Trim Position: 11 3' Trim Position: 524
Processed Sequence:
(Transposon Sequence in Red)
ATACGACTCCTATAGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTACGTCGCTCTGGAATGGGT
GAAAGGCGAGATCGCCGAAACCCTGAAACAGGCGCGCCAGGCGCTGGAAGCGTTCGTCGAGAACCCGCAG
GACCCGACCCGCATGCGGTTCTGCCTGACCTACGTGCACCAGGTGCAGGGCACCCTGCAGATGGTCGAGT
TCTACGGCGCGGCCCTGCTCGCCGAGGAAATGGAGCAGTTGGTCCAGGCCTTGCTGGACGGTCGCGTGCC
GAACCAGAGCGAGGCCCTGGAAGTGCTGATGCAGGCGATCCTGCAACTGCCGGTCTACCTCGACCGGATC
CAGACCGCCCGGCGCGACCTGCCGATGGTGGTCCTGCCGCTGCTCAACGACCTGCGCGCCGCGCGCGGCG
AGAAGCTGCTCTCGGAAAACCAGCCTGTTCGCGCCCGACCTGTCGCAGCGCCAGCCGCAATTGGACGGCG
AGGCCATCGCGCAACTGCGCACC
Blast against PA14
BLAST of Processed Sequence against PA14 And PAO1 Genome Sequence
64546 64546 64547 64547 64548 64548 64549 64549 64550 64550
PA14 BLAST Hit ID: 64546       Show Transposon Map
Identities: 462/463 (99.78%) BLAST Bit Score: 902.0 Percent of Processed Sequence That Aligns: 90.06%
Query Start: 51 Query End: 513 Subject Start: 468882 Subject End: 469343 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 468882 PA14_05390 +
Raw Sequence Start: 468821 PA14_05380 +
Extrapolated Insert Location: 468883 PA14_05390 +
Default Offset Location: 468884 PA14_05390 +
PA14 BLAST Hit ID: 64547       Show Transposon Map
Identities: 23/24 (95.83%) BLAST Bit Score: 40.1 Percent of Processed Sequence That Aligns: 4.48%
Query Start: 294 Query End: 317 Subject Start: 4608325 Subject End: 4608348 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 4608325 PA14_51900 +
Raw Sequence Start: 4608021 PA14_51890 -
Extrapolated Insert Location: 4608083
Default Offset Location: 4608084
PAO1 BLAST Hit ID: 64548       Show Transposon Map
Identities: 459/463 (99.13%) BLAST Bit Score: 878.0 Percent of Processed Sequence That Aligns: 90.06%
Query Start: 51 Query End: 513 Subject Start: 454144 Subject End: 454605 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 454144 PA0413 +
Raw Sequence Start: 454083 PA0412 +
Extrapolated Insert Location: 454145 PA0413 +
Default Offset Location: 454146 PA0413 +
PAO1 BLAST Hit ID: 64549       Show Transposon Map
Identities: 27/29 (93.10%) BLAST Bit Score: 42.1 Percent of Processed Sequence That Aligns: 5.46%
Query Start: 80 Query End: 108 Subject Start: 3198954 Subject End: 3198982 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 3198954 PA2843 +
Raw Sequence Start: 3198864 PA2843 +
Extrapolated Insert Location: 3198926 PA2843 +
Default Offset Location: 3198927 PA2843 +
PAO1 BLAST Hit ID: 64550       Show Transposon Map
Identities: 23/24 (95.83%) BLAST Bit Score: 40.1 Percent of Processed Sequence That Aligns: 4.48%
Query Start: 294 Query End: 317 Subject Start: 1043209 Subject End: 1043186 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 1043209 PA0956 +
Raw Sequence Start: 1043513 PA0957 -
Extrapolated Insert Location: 1043451
Default Offset Location: 1043450
H PA14 Blast Hit H PAO1 Blast Hit