Mutant Report for Mutant ID: 35670

Strain: PA14 Genetic Background: Wild Type Transposon: MrT7 Library: lib_04_04
Raw Sequence ID: 19431
Chromat Path: H:\Pa14\MrT7\372v1\372v1_E06_E6_040.ab1 Last Transposon Base: 63 Transposon Sequence
Match Quality: 0
Raw Sequence:
(Transposon Sequence in Red)
TGTTCAGTTTGTATACGACTCCTATAGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTACGTCTG
CTATGGCCTGATCGCTCGCGAAGTCGAGCGCGTCGACTCCGGCTATCGCTCGATGATGAGCGTGCAGTCC
TCGCTGGTGATGGTGCCAATCCATGAATTCGGCAACGAAGCCACCCGGCAGAAGTACCTGCCCAAGCTGG
CCAGCGGCGAATACATCGGCTGCTTCGGCCTGACCGAGCCGAACCACGGTTCCGACCCGGGCTCGATGGT
CACCCGGGCGAAGAAGGTCGACGGCGGCTATCGCCTGAGCGGCAGCAAGATGTGGATCACCAACAGCCCG
ATCGCCGACGTCTTCGTGGTCTGGGCCAAGGACGACGAAGGGCAGATCCGCGGTTTCGTCCTCGAGAAGG
GCTGGGAAGGCCTGAGCGCCCCGGCGATCCATGGCAAGGTCGGCCTGCGCGCCTCGATCACCGGCGAGAT
CGTGATGGACAACGTGTTCGTTCCGGAAGAGAACGCCTTCCCCGAGGTGCGCGGCCTGCGCGGTCCGTTC
ACCTGCCTGAACTCGGCGCGCTACGGCATCTCCTGGGGCGCCCTGGGCGCCGCCGAATTCTGCTGGCACA
CCGCCCGCCAGTACGTGCTCGACCGCCAGCAGTTCGGCCGCCCGCTGGCCGCCAACCAACTGATCCAGAA
GAAGCTGGCCGACATGCAGACCGAGATCACCCTGGCCCTGCAAGGCTGCCTGCGCCTGGNGCGGATGAAG
GACGAAGGCACCGCGGCGGTGGAAATCACCTCGATCATGAAGCGCACACTGGGGGGGAAGGCCCTACTAA
TCGCCCGCCTTGGCCCGCGACATACTTGGGGGGAACCTATCTTTTAA
Blast against PA14
Processed Seqquence ID: 14185
5' Trim Position: 12 3' Trim Position: 716
Processed Sequence:
(Transposon Sequence in Red)
ATACGACTCCTATAGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTACGTCTGCTATGGCCTGAT
CGCTCGCGAAGTCGAGCGCGTCGACTCCGGCTATCGCTCGATGATGAGCGTGCAGTCCTCGCTGGTGATG
GTGCCAATCCATGAATTCGGCAACGAAGCCACCCGGCAGAAGTACCTGCCCAAGCTGGCCAGCGGCGAAT
ACATCGGCTGCTTCGGCCTGACCGAGCCGAACCACGGTTCCGACCCGGGCTCGATGGTCACCCGGGCGAA
GAAGGTCGACGGCGGCTATCGCCTGAGCGGCAGCAAGATGTGGATCACCAACAGCCCGATCGCCGACGTC
TTCGTGGTCTGGGCCAAGGACGACGAAGGGCAGATCCGCGGTTTCGTCCTCGAGAAGGGCTGGGAAGGCC
TGAGCGCCCCGGCGATCCATGGCAAGGTCGGCCTGCGCGCCTCGATCACCGGCGAGATCGTGATGGACAA
CGTGTTCGTTCCGGAAGAGAACGCCTTCCCCGAGGTGCGCGGCCTGCGCGGTCCGTTCACCTGCCTGAAC
TCGGCGCGCTACGGCATCTCCTGGGGCGCCCTGGGCGCCGCCGAATTCTGCTGGCACACCGCCCGCCAGT
ACGTGCTCGACCGCCAGCAGTTCGGCCGCCCGCTGGCCGCCAACCAACTGATCCAGAAGAAGCTGGCCGA
CATG
Blast against PA14
BLAST of Processed Sequence against PA14 And PAO1 Genome Sequence
63753 63753 63754 63754 63755 63755 63756 63756 63757 63757 63758 63758 63759 63759 63760 63760 63761 63761 63762 63762 63763 63763
PA14 BLAST Hit ID: 63753       Show Transposon Map
Identities: 654/654 (100.00%) BLAST Bit Score: 999.9 Percent of Processed Sequence That Aligns: 92.76%
Query Start: 51 Query End: 704 Subject Start: 516942 Subject End: 516289 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 516942 PA14_05830*,PA14_05840 -,+
Raw Sequence Start: 517004 PA14_05830*,PA14_05840 -,+
Extrapolated Insert Location: 516941 PA14_05830*,PA14_05840 -,+
Default Offset Location: 516941 PA14_05830*,PA14_05840 -,+
PA14 BLAST Hit ID: 63754       Show Transposon Map
Identities: 25/25 (100.00%) BLAST Bit Score: 50.1 Percent of Processed Sequence That Aligns: 3.41%
Query Start: 308 Query End: 332 Subject Start: 3428313 Subject End: 3428337 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 3428313 PA14_38440 +
Raw Sequence Start: 3427994 PA14_38440 +
Extrapolated Insert Location: 3428057 PA14_38440 +
Default Offset Location: 3428057 PA14_38440 +
PA14 BLAST Hit ID: 63755       Show Transposon Map
Identities: 25/25 (100.00%) BLAST Bit Score: 50.1 Percent of Processed Sequence That Aligns: 3.41%
Query Start: 308 Query End: 332 Subject Start: 2326583 Subject End: 2326559 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 2326583 PA14_26700 +
Raw Sequence Start: 2326902 PA14_26700 +
Extrapolated Insert Location: 2326839 PA14_26700 +
Default Offset Location: 2326839 PA14_26700 +
PA14 BLAST Hit ID: 63756       Show Transposon Map
Identities: 25/26 (96.15%) BLAST Bit Score: 44.1 Percent of Processed Sequence That Aligns: 3.55%
Query Start: 183 Query End: 208 Subject Start: 4689903 Subject End: 4689878 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 4689903 PA14_52900 +
Raw Sequence Start: 4690097 PA14_52900 +
Extrapolated Insert Location: 4690034 PA14_52900 +
Default Offset Location: 4690034 PA14_52900 +
PA14 BLAST Hit ID: 63757       Show Transposon Map
Identities: 23/24 (95.83%) BLAST Bit Score: 40.1 Percent of Processed Sequence That Aligns: 3.27%
Query Start: 644 Query End: 667 Subject Start: 2223925 Subject End: 2223902 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 2223925 PA14_25440 -
Raw Sequence Start: 2224580 PA14_25450,PA14_25460* -,-
Extrapolated Insert Location: 2224517 PA14_25450,PA14_25460* -,-
Default Offset Location: 2224517 PA14_25450,PA14_25460* -,-
PAO1 BLAST Hit ID: 63758       Show Transposon Map
Identities: 648/654 (99.08%) BLAST Bit Score: 999.9 Percent of Processed Sequence That Aligns: 92.76%
Query Start: 51 Query End: 704 Subject Start: 503663 Subject End: 503010 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 503663 PA0447 +
Raw Sequence Start: 503725 PA0447 +
Extrapolated Insert Location: 503662 PA0447 +
Default Offset Location: 503662 PA0447 +
PAO1 BLAST Hit ID: 63759       Show Transposon Map
Identities: 25/25 (100.00%) BLAST Bit Score: 50.1 Percent of Processed Sequence That Aligns: 3.41%
Query Start: 308 Query End: 332 Subject Start: 3242775 Subject End: 3242799 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 3242775 PA2889 +
Raw Sequence Start: 3242456 PA2889 +
Extrapolated Insert Location: 3242519 PA2889 +
Default Offset Location: 3242519 PA2889 +
PAO1 BLAST Hit ID: 63760       Show Transposon Map
Identities: 25/25 (100.00%) BLAST Bit Score: 50.1 Percent of Processed Sequence That Aligns: 3.41%
Query Start: 308 Query End: 332 Subject Start: 2205886 Subject End: 2205862 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 2205886 PA2015 +
Raw Sequence Start: 2206205 PA2015 +
Extrapolated Insert Location: 2206142 PA2015 +
Default Offset Location: 2206142 PA2015 +
PAO1 BLAST Hit ID: 63761       Show Transposon Map
Identities: 25/26 (96.15%) BLAST Bit Score: 44.1 Percent of Processed Sequence That Aligns: 3.55%
Query Start: 183 Query End: 208 Subject Start: 961688 Subject End: 961713 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 961688 PA0879 +
Raw Sequence Start: 961494 PA0879 +
Extrapolated Insert Location: 961557 PA0879 +
Default Offset Location: 961557 PA0879 +
PAO1 BLAST Hit ID: 63762       Show Transposon Map
Identities: 24/25 (96.00%) BLAST Bit Score: 42.1 Percent of Processed Sequence That Aligns: 3.41%
Query Start: 516 Query End: 540 Subject Start: 4689514 Subject End: 4689490 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 4689514 PA4191 +
Raw Sequence Start: 4690041 PA4192 +
Extrapolated Insert Location: 4689978 PA4192 +
Default Offset Location: 4689978 PA4192 +
PAO1 BLAST Hit ID: 63763       Show Transposon Map
Identities: 23/24 (95.83%) BLAST Bit Score: 40.1 Percent of Processed Sequence That Aligns: 3.27%
Query Start: 644 Query End: 667 Subject Start: 3345402 Subject End: 3345425 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 3345402 PA2987 -
Raw Sequence Start: 3344747 PA2986 -
Extrapolated Insert Location: 3344810 PA2986 -
Default Offset Location: 3344810 PA2986 -
H PA14 Blast Hit H PAO1 Blast Hit