Mutant Report for Mutant ID: 35669

Strain: PA14 Genetic Background: Wild Type Transposon: MrT7 Library: lib_04_04
Raw Sequence ID: 19430
Chromat Path: H:\Pa14\MrT7\372v1\372v1_E05_E5_036.ab1 Last Transposon Base: 63 Transposon Sequence
Match Quality: 0
Raw Sequence:
(Transposon Sequence in Red)
TGTTCAGTTTGTATACGACTCCTATAGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTAGGTGAA
GGAATCGAAGTTATCCAACAGCGTGATGCGCATCGCGCTCTCCCCTTTCGCGTTCGGCAGCGGCCACGGC
GGTCAGCACCGCCAGCGCCTTGTTGCGGGTTTCCTCGGCCTCCAGCCGTGGATCCGAATCCAGCACCACG
CCGGCGCCTGCCCGGACCCGCGCGATACCTTCGCGGACCTCGGCGGAGCGGATGACGATGCTGGTATCGA
GGTTGCCGGCGCTGTCGAGAATGCCGATCGCGCCACCGTAGCTGCCGCGATAGCCATACTCGTACTGCCC
ATCATCTGCAGNGCCTGGGCCATCGGTTCAGCGCACCNNGACCAGGGTGGCCCATGTTCAGGCAGGCACN
GGTAGGCATGCAGCGCATCCAGTTCGCCATGCAGTTCGCCAGCCACGCGCGAGACCAGGTGCATCACGTG
GCTGTAGCGATCCACCTTGAGCATGACGCGCACCTGCCGCGTACCGCTGCGGCAGACCCGCGCCAGATCG
TTGCGCGCCAGGTCGACCAACATCATGTGCTCGGCGATCTCCTTGGCGTCCAGGCGCAACTCCGCTTCAC
AGCGATTGTCCAGTTCCGCATCGATGGCGCCCCGGGCATCTCGCACGCGCGGGCGAGTGCCGACAATGGA
GTAGAGTTCCACCTCGCGACTCTTCGAGTCAAAATTCAATGCCCACTCCAGCATAAACGCCCAACAGGCA
TAATATCCCCCGACATCAAGAAAAAAACAGGTAACGGGCTGTGGGTTGACCAAGCACAAACTGGAAAATA
GGCCCAGCCAGGGGACCCGCGAAACCGCATTGACTN
Blast against PA14
Processed Seqquence ID: 14184
5' Trim Position: 6 3' Trim Position: 603
Processed Sequence:
(Transposon Sequence in Red)
GTTTGTATACGACTCCTATAGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTAGGTGAAGGAATC
GAAGTTATCCAACAGCGTGATGCGCATCGCGCTCTCCCCTTTCGCGTTCGGCAGCGGCCACGGCGGTCAG
CACCGCCAGCGCCTTGTTGCGGGTTTCCTCGGCCTCCAGCCGTGGATCCGAATCCAGCACCACGCCGGCG
CCTGCCCGGACCCGCGCGATACCTTCGCGGACCTCGGCGGAGCGGATGACGATGCTGGTATCGAGGTTGC
CGGCGCTGTCGAGAATGCCGATCGCGCCACCGTAGCTGCCGCGATAGCCATACTCGTACTGCCCATCATC
TGCAGNGCCTGGGCCATCGGTTCAGCGCACCNNGACCAGGGTGGCCCATGTTCAGGCAGGCACNGGTAGG
CATGCAGCGCATCCAGTTCGCCATGCAGTTCGCCAGCCACGCGCGAGACCAGGTGCATCACGTGGCTGTA
GCGATCCACCTTGAGCATGACGCGCACCTGCCGCGTACCGCTGCGGCAGACCCGCGCCAGATCGTTGCGC
GCCAGGTCGACCAACATCATGTGCTCGGCGATCTCCT
Blast against PA14
BLAST of Processed Sequence against PA14 And PAO1 Genome Sequence
63747 63747 63748 63748 63749 63749 63750 63750 63751 63751 63752 63752
PA14 BLAST Hit ID: 63747       Show Transposon Map
Identities: 286/287 (99.65%) BLAST Bit Score: 561.0 Percent of Processed Sequence That Aligns: 47.91%
Query Start: 57 Query End: 343 Subject Start: 4564350 Subject End: 4564636 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 4564350 PA14_51350 -
Raw Sequence Start: 4564288 PA14_51350 -
Extrapolated Insert Location: 4564351 PA14_51350 -
Default Offset Location: 4564351 PA14_51350 -
PA14 BLAST Hit ID: 63748       Show Transposon Map
Identities: 210/214 (98.13%) BLAST Bit Score: 377.0 Percent of Processed Sequence That Aligns: 35.68%
Query Start: 384 Query End: 597 Subject Start: 4564671 Subject End: 4564882 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 4564671 PA14_51360,PA14_51370* -,+
Raw Sequence Start: 4564282 PA14_51350 -
Extrapolated Insert Location: 4564345 PA14_51350 -
Default Offset Location: 4564345 PA14_51350 -
PA14 BLAST Hit ID: 63749       Show Transposon Map
Identities: 42/46 (91.30%) BLAST Bit Score: 60.0 Percent of Processed Sequence That Aligns: 7.54%
Query Start: 552 Query End: 597 Subject Start: 684838 Subject End: 684793 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 684838 PA14_07920*,PA14_07940 +,-
Raw Sequence Start: 685395
Extrapolated Insert Location: 685332
Default Offset Location: 685332
PAO1 BLAST Hit ID: 63750       Show Transposon Map
Identities: 284/287 (98.95%) BLAST Bit Score: 545.0 Percent of Processed Sequence That Aligns: 47.91%
Query Start: 57 Query End: 343 Subject Start: 1085582 Subject End: 1085296 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 1085582 PA1002 -
Raw Sequence Start: 1085644 PA1002 -
Extrapolated Insert Location: 1085581 PA1002 -
Default Offset Location: 1085581 PA1002 -
PAO1 BLAST Hit ID: 63751       Show Transposon Map
Identities: 200/204 (98.03%) BLAST Bit Score: 365.0 Percent of Processed Sequence That Aligns: 34.00%
Query Start: 394 Query End: 597 Subject Start: 1085252 Subject End: 1085050 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 1085252 PA1001 -
Raw Sequence Start: 1085651 PA1002 -
Extrapolated Insert Location: 1085588 PA1002 -
Default Offset Location: 1085588 PA1002 -
PAO1 BLAST Hit ID: 63752       Show Transposon Map
Identities: 42/46 (91.30%) BLAST Bit Score: 60.0 Percent of Processed Sequence That Aligns: 7.54%
Query Start: 552 Query End: 597 Subject Start: 672016 Subject End: 671971 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 672016 PA0609 -
Raw Sequence Start: 672573
Extrapolated Insert Location: 672510
Default Offset Location: 672510
H PA14 Blast Hit H PAO1 Blast Hit