Mutant Report for Mutant ID: 35657

Strain: PA14 Genetic Background: Wild Type Transposon: MrT7 Library: lib_04_04
Raw Sequence ID: 19418
Chromat Path: H:\Pa14\MrT7\372v1\372v1_D05_D5_043.ab1 Last Transposon Base: 65 Transposon Sequence
Match Quality: 1
Raw Sequence:
(Transposon Sequence in Red)
TGTTCAGTTTGTATACGACTCACTATAGGGTGTCTAGAGACCGGAGACTTATCAGCCAACCTGTTACATT
GAGCACCGCCACCAGCAGTGCGCGCGTCTGTAGCGGTCGGTCGGCCAGGACCCGTCGGAAGATCGCCAGG
GTCGCGGGCTCGGGCGTGCCCGCCAGCAGCGGACGGGTTTCCGGCCAGGCCGGGACGACCAGCGCCGCCA
GCGAGGCGAGCAGCACCGCCAGGGTGGCGAACACCGCCGGGTGCCCGCCGAGGTCGGCCAGCCACTGGCC
GCCGAGGGGGCCGACTGCCGGCGACCAGGCCAGCACCGCGCCGAGCGTGACGAAATAGCTCATCAACGCC
GGGCCTTCATCATCTGCAGGCGTGGCCACTCCAAAATGTNNTTTTTTNNNGGTTGGNAGGAATGGAATTT
CAAGCAAATATATCTACATCAGTGTGGTGCTACATTCCTGTGTGGTGCAACAGGTAGCAAGTAGGGGGGT
AAGTCCGTCTACGTTCTTGTAAGAAAATGGCGAGTCCATTAGTCTTGTGTCAAATTGATTCTAGAGTTTA
GCCTTGATAAGTACGAATATGTGGCGGTTATTAGGTCTTCTATCTCTCCATGTCGAGCAACACACAGCAT
GCACTCGTGATTCATATATTTACCACATAGTGCGCGGGAGGGAAGACGAGATATAAAACGTGTACTAATT
TCAAAAATAAGTATACTATAAGAGTACTTTTCCTATTCTTACACCTCACCATGAAACTGGATATATTGAT
ATAGATCCTAGTTATAATAACTAACATAATACGATAATAATAACATATATCGGCATTGGTCCCGGATCCT
TACGTGACTTGATATTAAGTGTCTCACGATTACTTCCAATCTTATACTAGACAAGAAGTGGCGTATGCAG
CGAGGTATACTTATTGCACAATACCTCTCTCAACTATCTAACAATGCATATCCTCTATAGATCGATTACT
GAACTCGAGCGACATGTAAGGTGTACTAGT
Blast against PA14
Processed Seqquence ID: 14172
5' Trim Position: 23 3' Trim Position: 357
Processed Sequence:
(Transposon Sequence in Red)
TATAGGGTGTCTAGAGACCGGAGACTTATCAGCCAACCTGTTACATTGAGCACCGCCACCAGCAGTGCGC
GCGTCTGTAGCGGTCGGTCGGCCAGGACCCGTCGGAAGATCGCCAGGGTCGCGGGCTCGGGCGTGCCCGC
CAGCAGCGGACGGGTTTCCGGCCAGGCCGGGACGACCAGCGCCGCCAGCGAGGCGAGCAGCACCGCCAGG
GTGGCGAACACCGCCGGGTGCCCGCCGAGGTCGGCCAGCCACTGGCCGCCGAGGGGGCCGACTGCCGGCG
ACCAGGCCAGCACCGCGCCGAGCGTGACGAAATAGCTCATCAACGCCGGGCCTT
Blast against PA14
BLAST of Processed Sequence against PA14 And PAO1 Genome Sequence
63702 63702 63703 63703 63704 63704 63705 63705
PA14 BLAST Hit ID: 63702       Show Transposon Map
Identities: 293/293 (100.00%) BLAST Bit Score: 581.0 Percent of Processed Sequence That Aligns: 87.43%
Query Start: 42 Query End: 334 Subject Start: 4449376 Subject End: 4449084 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 4449376 PA14_50050 -
Raw Sequence Start: 4449440 PA14_50050 -
Extrapolated Insert Location: 4449375 PA14_50050 -
Default Offset Location: 4449377 PA14_50050 -
PA14 BLAST Hit ID: 63703       Show Transposon Map
Identities: 28/30 (93.33%) BLAST Bit Score: 44.1 Percent of Processed Sequence That Aligns: 8.68%
Query Start: 180 Query End: 209 Subject Start: 4638315 Subject End: 4638286 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 4638315 PA14_52260 -
Raw Sequence Start: 4638517 PA14_52260 -
Extrapolated Insert Location: 4638452 PA14_52260 -
Default Offset Location: 4638454 PA14_52260 -
PAO1 BLAST Hit ID: 63704       Show Transposon Map
Identities: 290/292 (99.31%) BLAST Bit Score: 563.0 Percent of Processed Sequence That Aligns: 87.13%
Query Start: 43 Query End: 334 Subject Start: 1200556 Subject End: 1200847 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 1200556 PA1108 -
Raw Sequence Start: 1200491 PA1108 -
Extrapolated Insert Location: 1200556 PA1108 -
Default Offset Location: 1200554 PA1108 -
PAO1 BLAST Hit ID: 63705       Show Transposon Map
Identities: 28/30 (93.33%) BLAST Bit Score: 44.1 Percent of Processed Sequence That Aligns: 8.68%
Query Start: 180 Query End: 209 Subject Start: 1013242 Subject End: 1013271 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 1013242 PA0928 -
Raw Sequence Start: 1013040 PA0928 -
Extrapolated Insert Location: 1013105 PA0928 -
Default Offset Location: 1013103 PA0928 -
H PA14 Blast Hit H PAO1 Blast Hit