Mutant Report for Mutant ID: 35284

Strain: PA14 Genetic Background: Wild Type Transposon: MrT7 Library: lib_04_04
Raw Sequence ID: 19141
Chromat Path: H:\Pa14\MrT7\368v1\368v1_E04_E4_033.ab1 Last Transposon Base: 114 Transposon Sequence
Match Quality: 0
Raw Sequence:
(Transposon Sequence in Red)
NTTTTTTTTTTTTTNNTNNTTTTTTTNTTTTTTTTTTTTTTNNNNNNNNNTCTGTTCGTTGTATACGACT
CACTATAGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTACTTCACCCGCAAGGCCTTCTCGGTG
GCCAAGCTCGGCATCGCCGAAGACCCTTCCTTCGAACTCGACAAGAGCGCCATGGCCGATCTCGATGCCC
TCTACCTGGCCGCCTACGCCGTGGGCCAGTTCATGTGGGGGGTGTTCGCCGACCGCTTCGGCACCCGCGT
GGTGGTGCTCGGCGGTTTGCTCACCTCGGCGCTGGCGGCGCTGGCGATGGGAACCTTCGCCACCCTGCCG
ATCTTCGCCGCCTGCATGGTGGTCCAGGGCCTGGCGCAATCCACCGGCTGGTCGGGGCTGTGCAAGAAAC
ATCGGCGCCTTTCTTCGCCACCTACGAGCGAGGCCGCGTGCTTCGGCTGTGGAGTACCTGCATCGCCTTC
GGAGGGCTGGCGGCGAAACCCTTCGCCCGGTTGGGCGAGCATACCGGTTTATCTATCATCTGTGGGGCGG
GGCTAATCTCTATCAATCATGCATAACTTAAGATCTCCCACGAACTATCACACCATTAGGTGAACGTAAT
ACTACATGGTGCGTGATAAAACTCACCATTACTCACCGCTTTACCAAAGCTAAAGATGGGATGAGCATAG
GAGAAATAAATAAGGAAGGTGATAGAAATAAGATTCATATAAAACAAAAAAAAAAATACATCATCACATA
CCTATACTAAGAAAAGCATATTTTAAATTGAAATAATAACAAACACATTATAAAAAAAGCAGAATATAAT
ACTGCCCTTACAGTTCCCTTGTTAATTAACTTCTCAAGATAATTGAATAATAAAATAAAAATATAAAAGT
TTAGGTATCGCCCCCATGGTTTTTAGGATATATTAATAGTAATTGAACGCCGGAGGAAATTATAA
Blast against PA14
Processed Seqquence ID: 13923
5' Trim Position: 60 3' Trim Position: 382
Processed Sequence:
(Transposon Sequence in Red)
GTATACGACTCACTATAGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTACTTCACCCGCAAGGC
CTTCTCGGTGGCCAAGCTCGGCATCGCCGAAGACCCTTCCTTCGAACTCGACAAGAGCGCCATGGCCGAT
CTCGATGCCCTCTACCTGGCCGCCTACGCCGTGGGCCAGTTCATGTGGGGGGTGTTCGCCGACCGCTTCG
GCACCCGCGTGGTGGTGCTCGGCGGTTTGCTCACCTCGGCGCTGGCGGCGCTGGCGATGGGAACCTTCGC
CACCCTGCCGATCTTCGCCGCCTGCATGGTGGTCCAGGGCCT
Blast against PA14
BLAST of Processed Sequence against PA14 And PAO1 Genome Sequence
62593 62593 62594 62594 62595 62595 62596 62596
PA14 BLAST Hit ID: 62593       Show Transposon Map
Identities: 268/269 (99.62%) BLAST Bit Score: 525.0 Percent of Processed Sequence That Aligns: 83.23%
Query Start: 54 Query End: 322 Subject Start: 4413881 Subject End: 4414149 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 4413881 PA14_49610,PA14_49600* +,-
Raw Sequence Start: 4413768 PA14_49600* -
Extrapolated Insert Location: 4413882 PA14_49610,PA14_49600* +,-
Default Offset Location: 4413831 PA14_49610,PA14_49600* +,-
PA14 BLAST Hit ID: 62594       Show Transposon Map
Identities: 222/263 (84.41%) BLAST Bit Score: 196.0 Percent of Processed Sequence That Aligns: 81.37%
Query Start: 57 Query End: 319 Subject Start: 3932423 Subject End: 3932685 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 3932423 PA14_44190 +
Raw Sequence Start: 3932307
Extrapolated Insert Location: 3932421 PA14_44190 +
Default Offset Location: 3932370 PA14_44190 +
PAO1 BLAST Hit ID: 62595       Show Transposon Map
Identities: 264/269 (98.14%) BLAST Bit Score: 494.0 Percent of Processed Sequence That Aligns: 83.23%
Query Start: 54 Query End: 322 Subject Start: 1236051 Subject End: 1235783 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 1236051 PA1144 +
Raw Sequence Start: 1236164
Extrapolated Insert Location: 1236050 PA1144 +
Default Offset Location: 1236101 PA1144 +
PAO1 BLAST Hit ID: 62596       Show Transposon Map
Identities: 222/263 (84.41%) BLAST Bit Score: 196.0 Percent of Processed Sequence That Aligns: 81.37%
Query Start: 57 Query End: 319 Subject Start: 1711083 Subject End: 1710821 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 1711083 PA1569 +
Raw Sequence Start: 1711199
Extrapolated Insert Location: 1711085 PA1569 +
Default Offset Location: 1711136 PA1569 +
H PA14 Blast Hit H PAO1 Blast Hit