Mutant Report for Mutant ID: 34510

Strain: PA14 Genetic Background: Wild Type Transposon: MrT7 Library: lib_04_04
Raw Sequence ID: 18271
Chromat Path: H:\Pa14\MrT7\360v1\360v1_D10_D10_080.ab1 Last Transposon Base: 59 Transposon Sequence
Match Quality: 0
Raw Sequence:
(Transposon Sequence in Red)
CCGTTTGTATACGACTCCTATAGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTACCTGTCCCAG
TTGCAGGGTTTCAACGCCCGGCCCATCGGCGACAGCCTGATCCTCTACGGCCTCGTGCAACTGCTCCTGG
CGCCGCTGCTGCCGCGCCTGATGCGCTGCCTGAACCCCAAGCTGCTGGTGGCCGGCGGCTTCGCGATCAT
GGCCCTGGGCTGCTGGATGGGCGCGCACCTGAACGCCGACGCGGGACGCAACGTGATCATCCCCTCCATC
GTCGTGCGCGGCATCGGCCAGCCGCTGATCATGGTCGCGCTCTCGGTACTGGCGGTGAAGGGCCTGGACA
AGGCCCAGGCCGGCTCGGCCTCGGCGCTGATCTCGATGCTGCGCAACCTCGGCGGCGCGATCGGCACCGC
GCTGTTGACGCAACTGGTCTCGCTGCGCGAGCGCTTCCACTCCGAGCGGATCGGCGAGACCCTGACGATC
TTCGACGGCGCCCTGCAACAGCGCCTGGGCGGTAGCCAGGTGCGGATACAACTGCCGGACATCTCTTNNN
GGGCCTTGGCCATGATNGNACNCGGGGGTGCGCCCGCAGGCCTACCTGATGGCCTACTCCGAACGCNTCT
ACCTTTCCTGCGTGGCGCTCCTGGCCTGCCGCCCTGGCCCTCGCTGATGCTGCCCCCAGAAGGACTGAAA
CTAATCGCCCCTCGGCCCCCCCGTTAGGCGGCGCCCCCCGCCGGAAATGGAGGGGTGCCCGCGANNGNNN
NANGGNNCCCGGGCTAANANGGGGGGNNGAAAGGGGGNNTTGGGGGGGGGGNAAGGCGAAGGGCCAAGGG
GGGGACCCCCAAGGGAACGAAAAGGGCCGGGCCCGCCAGGCGGCACCGAAGGG
Blast against PA14
Processed Seqquence ID: 13169
5' Trim Position: 1 3' Trim Position: 619
Processed Sequence:
(Transposon Sequence in Red)
CGTTTGTATACGACTCCTATAGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTACCTGTCCCAGT
TGCAGGGTTTCAACGCCCGGCCCATCGGCGACAGCCTGATCCTCTACGGCCTCGTGCAACTGCTCCTGGC
GCCGCTGCTGCCGCGCCTGATGCGCTGCCTGAACCCCAAGCTGCTGGTGGCCGGCGGCTTCGCGATCATG
GCCCTGGGCTGCTGGATGGGCGCGCACCTGAACGCCGACGCGGGACGCAACGTGATCATCCCCTCCATCG
TCGTGCGCGGCATCGGCCAGCCGCTGATCATGGTCGCGCTCTCGGTACTGGCGGTGAAGGGCCTGGACAA
GGCCCAGGCCGGCTCGGCCTCGGCGCTGATCTCGATGCTGCGCAACCTCGGCGGCGCGATCGGCACCGCG
CTGTTGACGCAACTGGTCTCGCTGCGCGAGCGCTTCCACTCCGAGCGGATCGGCGAGACCCTGACGATCT
TCGACGGCGCCCTGCAACAGCGCCTGGGCGGTAGCCAGGTGCGGATACAACTGCCGGACATCTCTTNNNG
GGCCTTGGCCATGATNGNACNCGGGGGTGCGCCCGCAGGCCTACCTGATGGCCTACTC
Blast against PA14
BLAST of Processed Sequence against PA14 And PAO1 Genome Sequence
59570 59570 59571 59571 59572 59572 59573 59573 59574 59574 59575 59575 59576 59576 59577 59577
PA14 BLAST Hit ID: 59570       Show Transposon Map
Identities: 488/491 (99.38%) BLAST Bit Score: 950.0 Percent of Processed Sequence That Aligns: 79.29%
Query Start: 58 Query End: 548 Subject Start: 4297534 Subject End: 4298024 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 4297534 PA14_48290*,PA14_48300 -,+
Raw Sequence Start: 4297476 PA14_48290*,PA14_48300 -,+
Extrapolated Insert Location: 4297535 PA14_48290*,PA14_48300 -,+
Default Offset Location: 4297539 PA14_48290*,PA14_48300 -,+
PA14 BLAST Hit ID: 59571       Show Transposon Map
Identities: 34/35 (97.14%) BLAST Bit Score: 61.9 Percent of Processed Sequence That Aligns: 5.50%
Query Start: 584 Query End: 618 Subject Start: 4298056 Subject End: 4298090 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 4298056 PA14_48300 +
Raw Sequence Start: 4297472 PA14_48290*,PA14_48300 -,+
Extrapolated Insert Location: 4297531 PA14_48290*,PA14_48300 -,+
Default Offset Location: 4297535 PA14_48290*,PA14_48300 -,+
PA14 BLAST Hit ID: 59572       Show Transposon Map
Identities: 27/28 (96.42%) BLAST Bit Score: 48.1 Percent of Processed Sequence That Aligns: 4.37%
Query Start: 388 Query End: 415 Subject Start: 2048076 Subject End: 2048049 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 2048076 PA14_23520 +
Raw Sequence Start: 2048464 PA14_23520 +
Extrapolated Insert Location: 2048405 PA14_23520 +
Default Offset Location: 2048401 PA14_23520 +
PA14 BLAST Hit ID: 59573       Show Transposon Map
Identities: 20/20 (100.00%) BLAST Bit Score: 40.1 Percent of Processed Sequence That Aligns: 3.07%
Query Start: 359 Query End: 378 Subject Start: 2843659 Subject End: 2843678 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 2843659 PA14_32740,PA14_32730* +,-
Raw Sequence Start: 2843300 PA14_32740,PA14_32730* +,-
Extrapolated Insert Location: 2843359 PA14_32740,PA14_32730* +,-
Default Offset Location: 2843363 PA14_32740,PA14_32730* +,-
PAO1 BLAST Hit ID: 59574       Show Transposon Map
Identities: 485/491 (98.77%) BLAST Bit Score: 926.0 Percent of Processed Sequence That Aligns: 79.29%
Query Start: 58 Query End: 548 Subject Start: 1337062 Subject End: 1336572 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 1337062 PA1236 +
Raw Sequence Start: 1337120 PA1236 +
Extrapolated Insert Location: 1337061 PA1236 +
Default Offset Location: 1337057 PA1236 +
PAO1 BLAST Hit ID: 59575       Show Transposon Map
Identities: 34/35 (97.14%) BLAST Bit Score: 61.9 Percent of Processed Sequence That Aligns: 5.50%
Query Start: 584 Query End: 618 Subject Start: 1336540 Subject End: 1336506 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 1336540 PA1236 +
Raw Sequence Start: 1337124 PA1236 +
Extrapolated Insert Location: 1337065 PA1236 +
Default Offset Location: 1337061 PA1236 +
PAO1 BLAST Hit ID: 59576       Show Transposon Map
Identities: 27/28 (96.42%) BLAST Bit Score: 48.1 Percent of Processed Sequence That Aligns: 4.37%
Query Start: 388 Query End: 415 Subject Start: 3520211 Subject End: 3520238 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 3520211 PA3137 +
Raw Sequence Start: 3519823 PA3137 +
Extrapolated Insert Location: 3519882 PA3137 +
Default Offset Location: 3519886 PA3137 +
PAO1 BLAST Hit ID: 59577       Show Transposon Map
Identities: 20/20 (100.00%) BLAST Bit Score: 40.1 Percent of Processed Sequence That Aligns: 3.07%
Query Start: 359 Query End: 378 Subject Start: 2783712 Subject End: 2783693 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 2783712 PA2466 +
Raw Sequence Start: 2784071 PA2466 +
Extrapolated Insert Location: 2784012 PA2466 +
Default Offset Location: 2784008 PA2466 +
H PA14 Blast Hit H PAO1 Blast Hit