Mutant Report for Mutant ID: 34437

Strain: PA14 Genetic Background: Wild Type Transposon: MrT7 Library: lib_04_04
Raw Sequence ID: 18198
Chromat Path: H:\Pa14\MrT7\359v1\359v1_F09_F9_077.ab1 Last Transposon Base: 63 Transposon Sequence
Match Quality: 0
Raw Sequence:
(Transposon Sequence in Red)
TGTTCAGTTTGTATACGACTCCTATAGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTATGGCCA
CATCGGCAGGCGACGCGGGCGGCGGTAACAGAGCGAGACGATCGTTTCGTGGGCGAGGGCGCGGCCGACG
ACGTCGACCTCCGCGTCGGCGACGTCCAGCACCAGCATGGCGTTGGCGGTATAGCCCAGGGCGCGGTGGT
GGAGGATCACTCCGAAGCGGCGGAACAGGCCGTCTTCGTCCCAGCGGCGGACCTGTTCCAGCACTTCGTC
TTCGCCGGCGCCGATGCGTTCGGCGAGCACCCGGTAGGGCCGGCTGGCCAGCGGCAGGCCCTGTTCCAGC
AGGTAGCGCAGGTGTTGCCGCTGCGGCGCGGCGAGGGGTTCGACGGGGTTCATCGGCTGGCCTCCAGGGG
AAACGCGAGGTCGATGCAGTAGGCTTCCTGCATCGGCAGGTCGAGGGGTTGCAGGCCGGTGTCGGCGGCG
ATCTCCGCCAGTACCCGGTCGAGTTGCGCGCGGTCGCCGGCGGTGAGCACGAACCACAGGTTGTAGCGGT
GTTCGCGCTGGTAGTTGTGGTTGACCTCGGCGTACTGGCTGATGCGCTCGGCGACCCGTTGCAGACGCTC
CTCGGGCACCGCCAGGGCAGCCAGGGTGCTGGCCCCGGCGCGTTGGTGGCGGAGCACGGGCCGACCCGCG
ACAACGCGCCGTCGGCTTCCGGCGACGCAGCCGTTCGAGCACCTCGGCTTCGCTGCAACCAGGGTCTCGG
CCATCCGCCGATACCGTTCGCACCTCTTTTGAAGGGGCCTGGACAANTNNTNNNNCNNTTNTNNTTNTTT
TTTTTTTTA
Blast against PA14
Processed Seqquence ID: 13097
5' Trim Position: 3 3' Trim Position: 681
Processed Sequence:
(Transposon Sequence in Red)
TCAGTTTGTATACGACTCCTATAGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTATGGCCACAT
CGGCAGGCGACGCGGGCGGCGGTAACAGAGCGAGACGATCGTTTCGTGGGCGAGGGCGCGGCCGACGACG
TCGACCTCCGCGTCGGCGACGTCCAGCACCAGCATGGCGTTGGCGGTATAGCCCAGGGCGCGGTGGTGGA
GGATCACTCCGAAGCGGCGGAACAGGCCGTCTTCGTCCCAGCGGCGGACCTGTTCCAGCACTTCGTCTTC
GCCGGCGCCGATGCGTTCGGCGAGCACCCGGTAGGGCCGGCTGGCCAGCGGCAGGCCCTGTTCCAGCAGG
TAGCGCAGGTGTTGCCGCTGCGGCGCGGCGAGGGGTTCGACGGGGTTCATCGGCTGGCCTCCAGGGGAAA
CGCGAGGTCGATGCAGTAGGCTTCCTGCATCGGCAGGTCGAGGGGTTGCAGGCCGGTGTCGGCGGCGATC
TCCGCCAGTACCCGGTCGAGTTGCGCGCGGTCGCCGGCGGTGAGCACGAACCACAGGTTGTAGCGGTGTT
CGCGCTGGTAGTTGTGGTTGACCTCGGCGTACTGGCTGATGCGCTCGGCGACCCGTTGCAGACGCTCCTC
GGGCACCGCCAGGGCAGCCAGGGTGCTGGCCCCGGCGCGTTGGTGGCG
Blast against PA14
BLAST of Processed Sequence against PA14 And PAO1 Genome Sequence
59203 59203 59204 59204 59205 59205 59206 59206 59207 59207 59208 59208
PA14 BLAST Hit ID: 59203       Show Transposon Map
Identities: 619/619 (100.00%) BLAST Bit Score: 999.9 Percent of Processed Sequence That Aligns: 91.15%
Query Start: 60 Query End: 678 Subject Start: 585677 Subject End: 586295 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 585677 PA14_06700 -
Raw Sequence Start: 585615 PA14_06700 -
Extrapolated Insert Location: 585678 PA14_06700 -
Default Offset Location: 585678 PA14_06700 -
PA14 BLAST Hit ID: 59204       Show Transposon Map
Identities: 31/34 (91.17%) BLAST Bit Score: 44.1 Percent of Processed Sequence That Aligns: 4.87%
Query Start: 139 Query End: 172 Subject Start: 3383819 Subject End: 3383852 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 3383819 PA14_37910 -
Raw Sequence Start: 3383678 PA14_37910 -
Extrapolated Insert Location: 3383741 PA14_37910 -
Default Offset Location: 3383741 PA14_37910 -
PA14 BLAST Hit ID: 59205       Show Transposon Map
Identities: 20/20 (100.00%) BLAST Bit Score: 40.1 Percent of Processed Sequence That Aligns: 2.80%
Query Start: 511 Query End: 530 Subject Start: 5842703 Subject End: 5842722 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 5842703 PA14_65590 -
Raw Sequence Start: 5842190 PA14_65580 +
Extrapolated Insert Location: 5842253 PA14_65580 +
Default Offset Location: 5842253 PA14_65580 +
PAO1 BLAST Hit ID: 59206       Show Transposon Map
Identities: 616/619 (99.51%) BLAST Bit Score: 999.9 Percent of Processed Sequence That Aligns: 91.15%
Query Start: 60 Query End: 678 Subject Start: 575700 Subject End: 576318 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 575700 PA0514 -
Raw Sequence Start: 575638 PA0514 -
Extrapolated Insert Location: 575701 PA0514 -
Default Offset Location: 575701 PA0514 -
PAO1 BLAST Hit ID: 59207       Show Transposon Map
Identities: 31/34 (91.17%) BLAST Bit Score: 44.1 Percent of Processed Sequence That Aligns: 4.87%
Query Start: 139 Query End: 172 Subject Start: 2250380 Subject End: 2250347 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 2250380 PA2056 -
Raw Sequence Start: 2250521 PA2056 -
Extrapolated Insert Location: 2250458 PA2056 -
Default Offset Location: 2250458 PA2056 -
PAO1 BLAST Hit ID: 59208       Show Transposon Map
Identities: 20/20 (100.00%) BLAST Bit Score: 40.1 Percent of Processed Sequence That Aligns: 2.80%
Query Start: 511 Query End: 530 Subject Start: 5571312 Subject End: 5571331 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 5571312 PA4963 -
Raw Sequence Start: 5570799 PA4962 +
Extrapolated Insert Location: 5570862 PA4962 +
Default Offset Location: 5570862 PA4962 +
H PA14 Blast Hit H PAO1 Blast Hit