Mutant Report for Mutant ID: 34068

Strain: PA14 Genetic Background: Wild Type Transposon: MrT7 Library: lib_04_04
Raw Sequence ID: 17830
Chromat Path: H:\Pa14\MrT7\355v1\355v1_G12_G12_100.ab1 Last Transposon Base: 31 Transposon Sequence
Match Quality: 0
Raw Sequence:
(Transposon Sequence in Red)
CTTAGACCGGGGACTTATCAGCCAACCTGTTACGGCGGTCGGGCCAACGCCGACCCGCGGGCGTTCCTCG
GTTCGCTCGAAGGCTTCCGCCGGCGTGCCAACAACGCCCAGTTGAACGCCTTCGAGGTGACCCCGGCGTT
CGCCGCGGCGGTGATCATCGCCCATCTGGTCGGCAACGCTTCGCAGGCGACCCTGGATAGCCTGGCCATT
GCCTGGATCACCAGTCGCCTGCTCTACGTCATCTGCTACCTCGCCGACTGGGGGCCGTTGCGCTCGCTGG
TCTGGTTCGTCGGCATGCTGCTCATCGCCGCGTTCTTCGTGGTTTCCGCCTGAGCAGCCCGCTGCGGCCT
ATGGCCGCAGTGCGGGCGCGCGGCTCTGGATCAATCGGCGGTGGCGGCGGATAATCCGCCGCTTCCGTGA
TCGACCCTGAAAAAAAAGAGCCTTGCCATGAAGCTGAAGTCCCTGCTCATCATCTGCAGGGCCTGGCACA
AACTTTCACTACTTGTCACTGTTTGTTGAAGAAAACGTTTCCGAGGTTAGAGTTATGTATACAAGTTGTG
AAGGTTTCTTCACCAGCATAGACTGATTCCATGCGTCGTTCCGTTACTCTTTACCCATATTTAAAATGTA
AGTCCACGCGTCTTAACCATCCCCCATTGTTAATTTTGTTCGTCCGTAACTTAGTAGACTACTTTCTCTG
TATCTTCACACCTTCATAAAAATCATCTAAGTCCGCGTTCGCCCACCTCCGTATGGTTTAGCCTTCACGA
AATTAGATTTCATAGATTCTTACCGTTGAATTAATAACACCGCAGCCTATCATTAGCTACCACAGCTTTG
TTTTATCTCTATTTTTTCCCTTTTCACTCTT
Blast against PA14
Processed Seqquence ID: 12753
5' Trim Position: 1 3' Trim Position: 482
Processed Sequence:
(Transposon Sequence in Red)
TTAGACCGGGGACTTATCAGCCAACCTGTTACGGCGGTCGGGCCAACGCCGACCCGCGGGCGTTCCTCGG
TTCGCTCGAAGGCTTCCGCCGGCGTGCCAACAACGCCCAGTTGAACGCCTTCGAGGTGACCCCGGCGTTC
GCCGCGGCGGTGATCATCGCCCATCTGGTCGGCAACGCTTCGCAGGCGACCCTGGATAGCCTGGCCATTG
CCTGGATCACCAGTCGCCTGCTCTACGTCATCTGCTACCTCGCCGACTGGGGGCCGTTGCGCTCGCTGGT
CTGGTTCGTCGGCATGCTGCTCATCGCCGCGTTCTTCGTGGTTTCCGCCTGAGCAGCCCGCTGCGGCCTA
TGGCCGCAGTGCGGGCGCGCGGCTCTGGATCAATCGGCGGTGGCGGCGGATAATCCGCCGCTTCCGTGAT
CGACCCTGAAAAAAAAGAGCCTTGCCATGAAGCTGAAGTCCCTGCTCATCATCTGCAGGGC
Blast against PA14
BLAST of Processed Sequence against PA14 And PAO1 Genome Sequence
57608 57608 57609 57609
PA14 BLAST Hit ID: 57608       Show Transposon Map
Identities: 430/438 (98.17%) BLAST Bit Score: 811.0 Percent of Processed Sequence That Aligns: 90.85%
Query Start: 30 Query End: 467 Subject Start: 608666 Subject End: 609102 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 608666 PA14_07020 +
Raw Sequence Start: 608636 PA14_07020 +
Extrapolated Insert Location: 608667 PA14_07020 +
Default Offset Location: 608699 PA14_07020 +
PAO1 BLAST Hit ID: 57609       Show Transposon Map
Identities: 427/438 (97.48%) BLAST Bit Score: 787.0 Percent of Processed Sequence That Aligns: 90.85%
Query Start: 30 Query End: 467 Subject Start: 598692 Subject End: 599127 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 598692 PA0540 +
Raw Sequence Start: 598662 PA0540 +
Extrapolated Insert Location: 598693 PA0540 +
Default Offset Location: 598725 PA0540 +
H PA14 Blast Hit H PAO1 Blast Hit