Mutant Report for Mutant ID: 34037

Strain: PA14 Genetic Background: Wild Type Transposon: MrT7 Library: lib_04_04
Raw Sequence ID: 17804
Chromat Path: H:\Pa14\MrT7\355v1\355v1_E05_E5_039.ab1 Last Transposon Base: 25 Transposon Sequence
Match Quality: 1
Raw Sequence:
(Transposon Sequence in Red)
CCGGGGACTTATCAGCCAACCTGTTACGACCTGCTGATCGGTGCAGGCTGCGCGAAGAAGCTGGTGTTCT
CCTGGGGCGGCAACCCCGGTGTCGGTTCGCTGCACCGCCTGCGCGACGCGGTGGAGAAGGGCTGGCCGCA
CCCGCTGGAGATCGAGGAACACAGCCACGCCGACCTCGCCAACGCCTATGTCGCCGGCGCCTCCGGGCTG
CCCTTCGCGGTGCTGCGCGCCTACGCCGGCTCCGACCTGCCGAAGGTCAACCCGCTGATCCGCAGCGTCA
CCTGCCCGTTCACCGGCGAAGTGCTGGCGGCGGTGCCCTCGGTGCGCCCGGACGTCAGCGTGATCCACGC
GCAGAAGGTCGACCGCAAGGGCAACGTGCTGCTCTGGGGCATCCTCGGGGTGCAGAACAGTATGGGAGCT
GGCCGACAAATGCTGCAACGTCTCCGTCGAGGAGATCGTCGACTAACTGATACGCCCGATGAACGCCTGT
GTCCTGCCGATCTTGGGGCTAATAACCGTGTGCCTAGTGCCCGTTGGCGGGTTTACGTCCTATGCCACCG
GTCTCTCCGATTGCCATCACCGCTTTTACCATTATTGGGACCATACATCCGGAATCGAGAAAGCAATTCT
GAGTGGATCCGTAAAAACAACCCGCGTGATTTATGATTTCGTCCCTTTCCTGATTATACTTCACTGCCTT
GTGAACTAAAAACAACATCATTCATCCACCCCGTTACTGACTATAAGCATCCGGCCCCACTCTGCCACAT
GCGCTACAATATGCTCTTACTATGCTTATTTCACCCTGACACAGCACCCACCCAGGCACCCCTAACTCTC
TCTCCCATAGTAGTCGTTTCTTTCCGC
Blast against PA14
Processed Seqquence ID: 12728
5' Trim Position: 1 3' Trim Position: 400
Processed Sequence:
(Transposon Sequence in Red)
CGGGGACTTATCAGCCAACCTGTTACGACCTGCTGATCGGTGCAGGCTGCGCGAAGAAGCTGGTGTTCTC
CTGGGGCGGCAACCCCGGTGTCGGTTCGCTGCACCGCCTGCGCGACGCGGTGGAGAAGGGCTGGCCGCAC
CCGCTGGAGATCGAGGAACACAGCCACGCCGACCTCGCCAACGCCTATGTCGCCGGCGCCTCCGGGCTGC
CCTTCGCGGTGCTGCGCGCCTACGCCGGCTCCGACCTGCCGAAGGTCAACCCGCTGATCCGCAGCGTCAC
CTGCCCGTTCACCGGCGAAGTGCTGGCGGCGGTGCCCTCGGTGCGCCCGGACGTCAGCGTGATCCACGCG
CAGAAGGTCGACCGCAAGGGCAACGTGCTGCTCTGGGGCATCCTCGGGG
Blast against PA14
BLAST of Processed Sequence against PA14 And PAO1 Genome Sequence
57489 57489 57490 57490 57491 57491 57492 57492
PA14 BLAST Hit ID: 57489       Show Transposon Map
Identities: 373/374 (99.73%) BLAST Bit Score: 733.0 Percent of Processed Sequence That Aligns: 93.48%
Query Start: 24 Query End: 397 Subject Start: 245800 Subject End: 246173 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 245800 PA14_02760 +
Raw Sequence Start: 245776 PA14_02760 +
Extrapolated Insert Location: 245801 PA14_02760 +
Default Offset Location: 245839 PA14_02760 +
PA14 BLAST Hit ID: 57490       Show Transposon Map
Identities: 21/21 (100.00%) BLAST Bit Score: 42.1 Percent of Processed Sequence That Aligns: 5.01%
Query Start: 295 Query End: 315 Subject Start: 5873150 Subject End: 5873170 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 5873150 PA14_65930*,PA14_65940 -,+
Raw Sequence Start: 5872855 PA14_65930*,PA14_65940 -,+
Extrapolated Insert Location: 5872880 PA14_65930*,PA14_65940 -,+
Default Offset Location: 5872918 PA14_65930*,PA14_65940 -,+
PAO1 BLAST Hit ID: 57491       Show Transposon Map
Identities: 369/374 (98.66%) BLAST Bit Score: 702.0 Percent of Processed Sequence That Aligns: 93.48%
Query Start: 24 Query End: 397 Subject Start: 255649 Subject End: 256022 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 255649 PA0226 +
Raw Sequence Start: 255625 PA0226 +
Extrapolated Insert Location: 255650 PA0226 +
Default Offset Location: 255688 PA0226 +
PAO1 BLAST Hit ID: 57492       Show Transposon Map
Identities: 20/20 (100.00%) BLAST Bit Score: 40.1 Percent of Processed Sequence That Aligns: 4.76%
Query Start: 295 Query End: 314 Subject Start: 1647741 Subject End: 1647722 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 1647741 PA1515 +
Raw Sequence Start: 1648036 PA1515 +
Extrapolated Insert Location: 1648011 PA1515 +
Default Offset Location: 1647973 PA1515 +
H PA14 Blast Hit H PAO1 Blast Hit