Mutant Report for Mutant ID: 32687

Strain: PA14 Genetic Background: Wild Type Transposon: MrT7 Library: lib_04_04
Raw Sequence ID: 14927
Chromat Path: H:\Pa14\MrT7\341v1\341v1_D11_D11_094.ab1 Last Transposon Base: 120 Transposon Sequence
Match Quality: 1
Raw Sequence:
(Transposon Sequence in Red)
NCTCTTTCCCCNCNCTNCCTTCCCCTCTCATCTCTCCTTTTCTTTCTNNNANAAAAATGTTCCGTTTGTA
TACAACTCACTATAGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTATGGCGGTTCCGGCGGCGG
GGGCGGCGGCTTCGGCGAGCCGGTGCAGATCAACTGCTACCAGCAGGTGGTCTATGACGGCTTCGAGGCG
GGCCGGCGCTATCGCCTGGAGGTGCGCCCGCAATTGCGCAGGGCGCTGGCGCTACTGAGCGACGAGCGTG
GCGAGGTGGTCGCCCGTTCGAACTTCCAGACCAGCCGCTGCCCGCCGTACTGAAACGCAGCGGCTCAGTC
GTCGTTCTTCTGGTAGATGATCTTCTTGGTGCCGTTCTCGCAACTGCCGACCACCATGTTCGGGTCGCTG
ACTTCGTCGTTGCGCACGATCTCCAGGGTGTAGGAGGTCACCCCGGCCGACTGGATCTTGGTCTCGATCT
CCGCCTTGAGTTCCTCGCACGGCTTCGGCGCGGCCAGCGCCGTGGCGCTGAACAGCAAGGTGGCAATCCC
CAGCCCGATGGTTTTCATGACCCGTCACTCCTCGTCGATGCCTGGCAGCCGAGTGCTGCGCAGCGCATCC
TGCCGCATTCGACTGCGGCAGGCCAGGGCCAGTTCGCCGGGCTGGGGAAGCGTTCCGCTCAGCCGTCGAG
GCTGGCGTCCAGGCTGATCTTCGCGTTGAGCACCTTGGATAACCGGGCAAACCGGTCTTGTCCTTGTAGG
CGAAAGGATCGTAAGTCTGCGCCGCTCACCCCCGGGCACGCGCGCCCTGGAACACCAGGTGTCCCGAGCT
ATGTATGGCGCAAACCCATCGGACTGCCTTGTTCAAGGGGTAACCTCCGTCCGCGGCGACTTCCAATTAC
TTTTACCTGCAGCTTTATTCATTCGTAGTCCACGCCCTAGAGCATAACGTTGNAGGCGCTGGG
Blast against PA14
Processed Seqquence ID: 10462
5' Trim Position: 72 3' Trim Position: 731
Processed Sequence:
(Transposon Sequence in Red)
CAACTCACTATAGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTATGGCGGTTCCGGCGGCGGGG
GCGGCGGCTTCGGCGAGCCGGTGCAGATCAACTGCTACCAGCAGGTGGTCTATGACGGCTTCGAGGCGGG
CCGGCGCTATCGCCTGGAGGTGCGCCCGCAATTGCGCAGGGCGCTGGCGCTACTGAGCGACGAGCGTGGC
GAGGTGGTCGCCCGTTCGAACTTCCAGACCAGCCGCTGCCCGCCGTACTGAAACGCAGCGGCTCAGTCGT
CGTTCTTCTGGTAGATGATCTTCTTGGTGCCGTTCTCGCAACTGCCGACCACCATGTTCGGGTCGCTGAC
TTCGTCGTTGCGCACGATCTCCAGGGTGTAGGAGGTCACCCCGGCCGACTGGATCTTGGTCTCGATCTCC
GCCTTGAGTTCCTCGCACGGCTTCGGCGCGGCCAGCGCCGTGGCGCTGAACAGCAAGGTGGCAATCCCCA
GCCCGATGGTTTTCATGACCCGTCACTCCTCGTCGATGCCTGGCAGCCGAGTGCTGCGCAGCGCATCCTG
CCGCATTCGACTGCGGCAGGCCAGGGCCAGTTCGCCGGGCTGGGGAAGCGTTCCGCTCAGCCGTCGAGGC
TGGCGTCCAGGCTGATCTTCGCGTTGAGC
Blast against PA14
BLAST of Processed Sequence against PA14 And PAO1 Genome Sequence
47834 47834 47835 47835 47836 47836 47837 47837 47838 47838 47839 47839
PA14 BLAST Hit ID: 47834       Show Transposon Map
Identities: 611/611 (100.00%) BLAST Bit Score: 999.9 Percent of Processed Sequence That Aligns: 92.56%
Query Start: 49 Query End: 659 Subject Start: 72135 Subject End: 71525 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 72135 PA14_00730 +
Raw Sequence Start: 72255 PA14_00730 +
Extrapolated Insert Location: 72135 PA14_00730 +
Default Offset Location: 72192 PA14_00730 +
PA14 BLAST Hit ID: 47835       Show Transposon Map
Identities: 20/20 (100.00%) BLAST Bit Score: 40.1 Percent of Processed Sequence That Aligns: 2.88%
Query Start: 70 Query End: 89 Subject Start: 3066298 Subject End: 3066279 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 3066298 PA14_34490,PA14_34480* -,+
Raw Sequence Start: 3066439 PA14_34490,PA14_34480* -,+
Extrapolated Insert Location: 3066319 PA14_34490,PA14_34480* -,+
Default Offset Location: 3066376 PA14_34490,PA14_34480* -,+
PA14 BLAST Hit ID: 47836       Show Transposon Map
Identities: 26/28 (92.85%) BLAST Bit Score: 40.1 Percent of Processed Sequence That Aligns: 4.10%
Query Start: 72 Query End: 99 Subject Start: 1242467 Subject End: 1242494 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 1242467 PA14_14530 +
Raw Sequence Start: 1242324 PA14_14530 +
Extrapolated Insert Location: 1242444 PA14_14530 +
Default Offset Location: 1242387 PA14_14530 +
PAO1 BLAST Hit ID: 47837       Show Transposon Map
Identities: 610/611 (99.83%) BLAST Bit Score: 999.9 Percent of Processed Sequence That Aligns: 92.56%
Query Start: 49 Query End: 659 Subject Start: 74491 Subject End: 73881 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 74491 PA0061 +
Raw Sequence Start: 74611 PA0061 +
Extrapolated Insert Location: 74491 PA0061 +
Default Offset Location: 74548 PA0061 +
PAO1 BLAST Hit ID: 47838       Show Transposon Map
Identities: 26/28 (92.85%) BLAST Bit Score: 40.1 Percent of Processed Sequence That Aligns: 4.10%
Query Start: 72 Query End: 99 Subject Start: 4283322 Subject End: 4283295 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 4283322 PA3825 +
Raw Sequence Start: 4283465 PA3825 +
Extrapolated Insert Location: 4283345 PA3825 +
Default Offset Location: 4283402 PA3825 +
PAO1 BLAST Hit ID: 47839       Show Transposon Map
Identities: 20/20 (100.00%) BLAST Bit Score: 40.1 Percent of Processed Sequence That Aligns: 2.88%
Query Start: 70 Query End: 89 Subject Start: 2571856 Subject End: 2571875 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 2571856 PA2330 -
Raw Sequence Start: 2571715 PA2330 -
Extrapolated Insert Location: 2571835 PA2330 -
Default Offset Location: 2571778 PA2330 -
H PA14 Blast Hit H PAO1 Blast Hit