Mutant Report for Mutant ID: 32429

Strain: PA14 Genetic Background: Wild Type Transposon: MrT7 Library: lib_04_04
Raw Sequence ID: 15821
Chromat Path: H:\Pa14\MrT7\338v1\338v1_G05_G5_038.ab1 Last Transposon Base: Transposon Sequence
Match Quality:
Raw Sequence:
(Transposon Sequence in Red)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTTNTTTCTTTNNNNTTTTNNNNACGTG
ATCAGTTTGTATACGACTCACTATAGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTACAGTCGC
GAGACCTACTACGACAACCAGGCCCGGGCGATGGCCGTGAATGCCGACGGCACCCTGACCCGGCGCATGG
ACGGCACCCACGGCGCGTTCAGCAGCGACAGATTCGCCACCCTCGGTCTGAGCGGAACGCTGCAACTGGC
CGGGATGCAACATGACCTGCACTCCGCCATGGACCACTAGAAGCGCATGATCTTCCGCGCCGACCTGCTG
CGCGACAGCAATACACATCCGCTTCGACAACCTCAACCCGGTTTATGGCCAGGTGGCGACGTCACATTTA
GGTGGTCGCCGGAGACCGCGAACATACCCCACTGCTGCTCAGCGACTCGCTGTACTTCCAGGACTCGAAC
CACCCGGGACGAACGCTGGATCATGGACAAATCCTCGGTTTTTCACACCAACAACCACTTACTTAGATAA
CTTCCAGTCGTACAACGCCCACATCATCTTTTTTTGGGCGGTTCTGAAAAGACTCTCATTACAATATCCA
TTAACCCGGAGCACGCCATAACAATTTCCGCCGTTTTTACCCCTCCCACCCCTACTTATCCCTCCATCCA
TCATCCCGCCTTAATACTCGTTTAGAATACTAATTATTTCCCTACCTTACTATACCAGTGACCCATATTA
CCCCAATGACCCACACTCCCTTATATTACCCCCTTTTCCCCCTTCCCCCCCTATTCCTACTTTACCCCAT
ACATTACCTCGCGTATCTTGCTCTTGGGACCACAATATTTTCTGTTCCAAACAACATTTTTTATTTATAT
ATACTACACTTTTGTCTCCCCGCTTTTGGCGCACGCCTGTCAATTATCCTCCACAATTTTACAATGATTC
TACGCCGCAACTAACGATGTT
Blast against PA14
Processed Seqquence ID: 11165
5' Trim Position: 81 3' Trim Position: 353
Processed Sequence:
(Transposon Sequence in Red)
TACGACTCACTATAGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTACAGTCGCGAGACCTACTA
CGACAACCAGGCCCGGGCGATGGCCGTGAATGCCGACGGCACCCTGACCCGGCGCATGGACGGCACCCAC
GGCGCGTTCAGCAGCGACAGATTCGCCACCCTCGGTCTGAGCGGAACGCTGCAACTGGCCGGGATGCAAC
ATGACCTGCACTCCGCCATGGACCACTAGAAGCGCATGATCTTCCGCGCCGACCTGCTGCGC
Blast against PA14
BLAST of Processed Sequence against PA14 And PAO1 Genome Sequence
50778 50778 50779 50779
PA14 BLAST Hit ID: 50778       Show Transposon Map
Identities: 212/222 (95.49%) BLAST Bit Score: 361.0 Percent of Processed Sequence That Aligns: 81.25%
Query Start: 51 Query End: 272 Subject Start: 171076 Subject End: 171297 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 171076 PA14_01870,PA14_01880* +,-
Raw Sequence Start: 170945 PA14_01870,PA14_01880* +,-
Extrapolated Insert Location:
Default Offset Location: 171008 PA14_01870,PA14_01880* +,-
PAO1 BLAST Hit ID: 50779       Show Transposon Map
Identities: 211/222 (95.04%) BLAST Bit Score: 353.0 Percent of Processed Sequence That Aligns: 81.25%
Query Start: 51 Query End: 272 Subject Start: 172226 Subject End: 172447 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 172226 PA0151 +
Raw Sequence Start: 172095 PA0151 +
Extrapolated Insert Location:
Default Offset Location: 172158 PA0151 +
H PA14 Blast Hit H PAO1 Blast Hit