Mutant Report for Mutant ID: 32409

Strain: PA14 Genetic Background: Wild Type Transposon: MrT7 Library: lib_04_04
Raw Sequence ID: 15801
Chromat Path: H:\Pa14\MrT7\338v1\338v1_E09_E9_069.ab1 Last Transposon Base: 60 Transposon Sequence
Match Quality: 0
Raw Sequence:
(Transposon Sequence in Red)
CCGTTTGTATACGACTCACTATAGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTACGCTGATCG
GCGGCTTCGAGCTGTCCCGCGAGACCTACGACCGCACCACCTACTCCTACAACCTGGGCAAGTTCTACCC
GGCCAACGGCTTCGACCTGCACAACCCGCCGGGCTACTGGAACGGCCCCACCGACAAGCGCGACAGCGCG
CGCAACCGGACCGAACTGGAGGTCAAGGCGCTGTACGCCTTCGACACCATCGCCCTGGACGAGCGCTGGG
ACCTCAGCCTGGGCCTGCGCTACGACTGGATCGACGGCACCTCGCGGAGCACGCCCTCAGGCAAGCCGAC
GGTGCGCGCCGACAGTTCCGACGGCAAGCTGAGCACACGGGCGGGGCTGGTATTCAAGCCGCTGGAGAAC
GGGCGGGTGTACGTCTCCTACGGCACCTCCTTCAACCCCTCGGCGGAACACCTGGTCACCACCGGCTCGG
GCGTGACCGAGGCGACCGGAGGCCTGGCGCCGGAGAAGAACAGCACCTACGAGCTGGGCACCAAGTGGGA
GTTCCTCGGACGGCGCCTGGAGCTGGACGCGGCGCTGTTCCGGTGAAAAAAGAAGACGCCCGCGAACGCC
TGGCCGACGGCAGCTACTTGCTTGCCGGCGAACAGCGCGTGCGTGGCCTGGAGCTGACCGCCAACCGCAA
GCTGAACGAGCACTGGGACCTCTTCGCCACCTACCCTAACTCGACGCGAAAACCTGAAATCAGTAACACG
CAGCGGGAGGAAAGGGCCTTGGGCAATACCCCCCCGCCCATCTTTGGAGGGCCTGGACAAAAGATAAAGC
CACAAGACCAATT
Blast against PA14
Processed Seqquence ID: 11148
5' Trim Position: 2 3' Trim Position: 545
Processed Sequence:
(Transposon Sequence in Red)
GTTTGTATACGACTCACTATAGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTACGCTGATCGGC
GGCTTCGAGCTGTCCCGCGAGACCTACGACCGCACCACCTACTCCTACAACCTGGGCAAGTTCTACCCGG
CCAACGGCTTCGACCTGCACAACCCGCCGGGCTACTGGAACGGCCCCACCGACAAGCGCGACAGCGCGCG
CAACCGGACCGAACTGGAGGTCAAGGCGCTGTACGCCTTCGACACCATCGCCCTGGACGAGCGCTGGGAC
CTCAGCCTGGGCCTGCGCTACGACTGGATCGACGGCACCTCGCGGAGCACGCCCTCAGGCAAGCCGACGG
TGCGCGCCGACAGTTCCGACGGCAAGCTGAGCACACGGGCGGGGCTGGTATTCAAGCCGCTGGAGAACGG
GCGGGTGTACGTCTCCTACGGCACCTCCTTCAACCCCTCGGCGGAACACCTGGTCACCACCGGCTCGGGC
GTGACCGAGGCGACCGGAGGCCTGGCGCCGGAGAAGAACAGCACCTACGAGCT
Blast against PA14
BLAST of Processed Sequence against PA14 And PAO1 Genome Sequence
50702 50702 50703 50703 50704 50704 50705 50705
PA14 BLAST Hit ID: 50702       Show Transposon Map
Identities: 486/486 (100.00%) BLAST Bit Score: 963.0 Percent of Processed Sequence That Aligns: 89.32%
Query Start: 58 Query End: 543 Subject Start: 4200328 Subject End: 4199843 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 4200328 PA14_47140 +
Raw Sequence Start: 4200387 PA14_47140 +
Extrapolated Insert Location: 4200327 PA14_47140 +
Default Offset Location: 4200324 PA14_47140 +
PA14 BLAST Hit ID: 50703       Show Transposon Map
Identities: 20/20 (100.00%) BLAST Bit Score: 40.1 Percent of Processed Sequence That Aligns: 3.50%
Query Start: 247 Query End: 266 Subject Start: 2472484 Subject End: 2472503 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 2472484 PA14_28700*,PA14_28710 -,+
Raw Sequence Start: 2472236 PA14_28700*,PA14_28710 -,+
Extrapolated Insert Location: 2472296 PA14_28700*,PA14_28710 -,+
Default Offset Location: 2472299 PA14_28700*,PA14_28710 -,+
PAO1 BLAST Hit ID: 50704       Show Transposon Map
Identities: 485/486 (99.79%) BLAST Bit Score: 955.0 Percent of Processed Sequence That Aligns: 89.32%
Query Start: 58 Query End: 543 Subject Start: 1434305 Subject End: 1434790 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 1434305 PA1322 +
Raw Sequence Start: 1434246 PA1322 +
Extrapolated Insert Location: 1434306 PA1322 +
Default Offset Location: 1434309 PA1322 +
PAO1 BLAST Hit ID: 50705       Show Transposon Map
Identities: 20/20 (100.00%) BLAST Bit Score: 40.1 Percent of Processed Sequence That Aligns: 3.50%
Query Start: 247 Query End: 266 Subject Start: 3101486 Subject End: 3101467 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 3101486 PA2739 +
Raw Sequence Start: 3101734 PA2739 +
Extrapolated Insert Location: 3101674 PA2739 +
Default Offset Location: 3101671 PA2739 +
H PA14 Blast Hit H PAO1 Blast Hit