Mutant Report for Mutant ID: 32340

Strain: PA14 Genetic Background: Wild Type Transposon: MrT7 Library: lib_04_04
Raw Sequence ID: 15732
Chromat Path: H:\Pa14\MrT7\337v1\337v1_G12_G12_098.ab1 Last Transposon Base: 63 Transposon Sequence
Match Quality: 0
Raw Sequence:
(Transposon Sequence in Red)
TGTTCAGTTTGTATACGACTCCTATAGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTAGTGGCT
GGCCAGGCGCAGGCTCCACTGCTCGTTGAGGTGATGGCGCAGGGTGGCCTGGAGGGTTTCGTTGTTGTTG
TCGATCTTGCCGTCGTCCGGTTCGCCGAAGAACCGCGAGCGCGGCAGGCTGCCCAGGTGGTTGTGCGGCG
CCACGGTGCCGCGGTCGAAGACCTGGCGGTTGCGCACCACCTCGGCTTCCACCAGCAACGAGGTGTCCGG
GTCCAGTTGCCAGCTGAACGATGGCGCCACCAGCAGGCGCTGGCCGTCGGCGTAGTCGCGGAAGCCCTTG
CTGTCCTCCACCGCCAGGTTCATCCGGTAGAGCAGGTCGCCCTCTTCGTCCAGCGGCGTGTTCAGGTCCA
GGGTCGAGCGGTAGCGGTCCCAGCTGCCGGCGCTGGCATGCAAGCGGGCGAAGCGCTCGGCCTGGGGCTT
CTTGGTCACCAGGTTCACCGTGCCGCCGGGATCGCCGCGCCCGTACAGGCTGGAGGCCGGTCCCTTGAGG
ATTTCCACGCGCTCGATGGTGGCGCTGTCCGGGGCGTTCATATAGCCGCGGTTGGCGCTGAAGCCGTCGC
GGTAGAACTCCGAAGTGGTGAAGCCACGGACGTTGTACTCGAACATCGTCAGGCCGCCGAGGTTGTTCTG
CCGCGAGACCCCGCCGGCGAAGTCCAGCGCCCCGTTCGATACGAGCGCTGTCAAGGTCGTCGAACACCTG
GCGCCGCCACCACGCTGAAGGCTTGCGGGATGTCCTCCATACTGTGGTCGGCATCTTCGGAGTGCCGGAC
AG
Blast against PA14
Processed Seqquence ID: 11084
5' Trim Position: 9 3' Trim Position: 612
Processed Sequence:
(Transposon Sequence in Red)
TGTATACGACTCCTATAGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTAGTGGCTGGCCAGGCG
CAGGCTCCACTGCTCGTTGAGGTGATGGCGCAGGGTGGCCTGGAGGGTTTCGTTGTTGTTGTCGATCTTG
CCGTCGTCCGGTTCGCCGAAGAACCGCGAGCGCGGCAGGCTGCCCAGGTGGTTGTGCGGCGCCACGGTGC
CGCGGTCGAAGACCTGGCGGTTGCGCACCACCTCGGCTTCCACCAGCAACGAGGTGTCCGGGTCCAGTTG
CCAGCTGAACGATGGCGCCACCAGCAGGCGCTGGCCGTCGGCGTAGTCGCGGAAGCCCTTGCTGTCCTCC
ACCGCCAGGTTCATCCGGTAGAGCAGGTCGCCCTCTTCGTCCAGCGGCGTGTTCAGGTCCAGGGTCGAGC
GGTAGCGGTCCCAGCTGCCGGCGCTGGCATGCAAGCGGGCGAAGCGCTCGGCCTGGGGCTTCTTGGTCAC
CAGGTTCACCGTGCCGCCGGGATCGCCGCGCCCGTACAGGCTGGAGGCCGGTCCCTTGAGGATTTCCACG
CGCTCGATGGTGGCGCTGTCCGGGGCGTTCATATAGCCGCGGT
Blast against PA14
BLAST of Processed Sequence against PA14 And PAO1 Genome Sequence
50474 50474 50475 50475 50476 50476 50477 50477 50478 50478 50479 50479 50480 50480 50481 50481 50482 50482
PA14 BLAST Hit ID: 50474       Show Transposon Map
Identities: 550/550 (100.00%) BLAST Bit Score: 999.9 Percent of Processed Sequence That Aligns: 91.04%
Query Start: 54 Query End: 603 Subject Start: 5699549 Subject End: 5700098 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 5699549 PA14_63960,PA14_63950* -,+
Raw Sequence Start: 5699487 PA14_63960,PA14_63950* -,+
Extrapolated Insert Location: 5699550 PA14_63960,PA14_63950* -,+
Default Offset Location: 5699550 PA14_63960,PA14_63950* -,+
PA14 BLAST Hit ID: 50475       Show Transposon Map
Identities: 24/25 (96.00%) BLAST Bit Score: 42.1 Percent of Processed Sequence That Aligns: 3.98%
Query Start: 305 Query End: 329 Subject Start: 1085267 Subject End: 1085291 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 1085267 PA14_12640 -
Raw Sequence Start: 1084954 PA14_12630 +
Extrapolated Insert Location: 1085017 PA14_12630 +
Default Offset Location: 1085017 PA14_12630 +
PA14 BLAST Hit ID: 50476       Show Transposon Map
Identities: 26/28 (92.85%) BLAST Bit Score: 40.1 Percent of Processed Sequence That Aligns: 4.48%
Query Start: 539 Query End: 566 Subject Start: 3548810 Subject End: 3548783 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 3548810 PA14_39820 -
Raw Sequence Start: 3549357 PA14_39820 -
Extrapolated Insert Location: 3549294 PA14_39820 -
Default Offset Location: 3549294 PA14_39820 -
PA14 BLAST Hit ID: 50477       Show Transposon Map
Identities: 26/28 (92.85%) BLAST Bit Score: 40.1 Percent of Processed Sequence That Aligns: 4.48%
Query Start: 419 Query End: 446 Subject Start: 800623 Subject End: 800596 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 800623 PA14_09330*,PA14_09340 +,-
Raw Sequence Start: 801050 PA14_09330*,PA14_09340 +,-
Extrapolated Insert Location: 800987 PA14_09330*,PA14_09340 +,-
Default Offset Location: 800987 PA14_09330*,PA14_09340 +,-
PAO1 BLAST Hit ID: 50478       Show Transposon Map
Identities: 546/550 (99.27%) BLAST Bit Score: 999.9 Percent of Processed Sequence That Aligns: 91.04%
Query Start: 54 Query End: 603 Subject Start: 5428907 Subject End: 5429456 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 5428907 PA4837 -
Raw Sequence Start: 5428845 PA4837 -
Extrapolated Insert Location: 5428908 PA4837 -
Default Offset Location: 5428908 PA4837 -
PAO1 BLAST Hit ID: 50479       Show Transposon Map
Identities: 24/25 (96.00%) BLAST Bit Score: 42.1 Percent of Processed Sequence That Aligns: 3.98%
Query Start: 305 Query End: 329 Subject Start: 4439738 Subject End: 4439714 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 4439738 PA3960 -
Raw Sequence Start: 4440051 PA3961 +
Extrapolated Insert Location: 4439988 PA3961 +
Default Offset Location: 4439988 PA3961 +
PAO1 BLAST Hit ID: 50480       Show Transposon Map
Identities: 26/28 (92.85%) BLAST Bit Score: 40.1 Percent of Processed Sequence That Aligns: 4.48%
Query Start: 419 Query End: 446 Subject Start: 4726195 Subject End: 4726222 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 4726195 PA4221 -
Raw Sequence Start: 4725768 PA4221 -
Extrapolated Insert Location: 4725831 PA4221 -
Default Offset Location: 4725831 PA4221 -
PAO1 BLAST Hit ID: 50481       Show Transposon Map
Identities: 20/20 (100.00%) BLAST Bit Score: 40.1 Percent of Processed Sequence That Aligns: 3.15%
Query Start: 307 Query End: 326 Subject Start: 2796180 Subject End: 2796199 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 2796180 PA2478 -
Raw Sequence Start: 2795865 PA2478 -
Extrapolated Insert Location: 2795928 PA2478 -
Default Offset Location: 2795928 PA2478 -
PAO1 BLAST Hit ID: 50482       Show Transposon Map
Identities: 26/28 (92.85%) BLAST Bit Score: 40.1 Percent of Processed Sequence That Aligns: 4.48%
Query Start: 539 Query End: 566 Subject Start: 2083521 Subject End: 2083548 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 2083521 PA1910 -
Raw Sequence Start: 2082974 PA1910 -
Extrapolated Insert Location: 2083037 PA1910 -
Default Offset Location: 2083037 PA1910 -
H PA14 Blast Hit H PAO1 Blast Hit