Mutant Report for Mutant ID: 32272

Strain: PA14 Genetic Background: Wild Type Transposon: MrT7 Library: lib_04_04
Raw Sequence ID: 15664
Chromat Path: H:\Pa14\MrT7\337v1\337v1_B04_B4_031.ab1 Last Transposon Base: 120 Transposon Sequence
Match Quality: 6
Raw Sequence:
(Transposon Sequence in Red)
NTTTTTTTTTNNTTTTTTTTTTNTTTTTTTTTTTTTTTTTTTTTTTTCTNTTTTTTTCCGGTGTTCGGTT
GTATACGACTCACTATAGGGGTCTAGAGACCGGGGTACTTATCAGCCAACCTGTTACAAGGCGCGCTCGC
TGGAGGAACGCCAGGCGATGATCGCCGCGGTGGCGGGGATCAGTCCGATCGGCCTGCGCCACGATACGCG
CGAGACCCATCGTCTGCAGGCCTGGCCACTGATCGCGCTGCCCGAGGACCTCGGCTTCCGCCGCACCTTC
TTCTCGTGCGAGCTGCTGGCGGCTAAGAGTTTCTCCTAGCTGTCTGAGCGTCTCTTATGTGAGTTCCAGG
TATCGTAGCGTTTCAGGAACTGTGGTTTAACGCCGTCTCCTTCTTTCGCGTTTCTCCCTTCCCTGTCATC
TGTTGAATGAGTGTTCTACTTTCTGTTGGGCGCCCTCCTCTGAGCCCTCCTTCCCATGCCTACCCCTGTT
CCTGTACTTACGAATCAGTCATTGTAACGTTTATCTCTCTTTCTGATCCTTCTTTTTGCGTCCACGCGGC
TCAATGCTTTTCTAGACGTTTCATTTTACGGATAATCCTTATTCTTTAATTCCTTTCCCGTTTTCGCGCC
CGTGTTATCCCCCTTTTACTACCCTTAGTGTTTTTGGTGTATTCTCGCGCTTTCCCCCCTTGTCTTGCGC
GCGGCTTGTCCTTCATTTCCCTTCTATTCCCCCCCCTTCTTCTCCTGTTTTCCCCCCCTTCCTTCTTATG
TCACTGATTCGATTTTGTGGGGAGGAGGGATGTTAGTCATACACCTATAGTATATTTTATAACGATAGTA
AGAATCACCTTCCCTCTTAACTTTGCTAAAATACCCACAAACATTAATTAACCGCACCAACTTTCCCATT
ATTTTTTTTCCCTCCTTCTTCTTTTCTCTGCCTCCTTTAGGCTCTTCTCATTCTTAN
Blast against PA14
Processed Seqquence ID: 11021
5' Trim Position: 20 3' Trim Position: 259
Processed Sequence:
(Transposon Sequence in Red)
TTNTTTTTTTTTTTTTTTTTTTTTTTTCTNTTTTTTTCCGGTGTTCGGTTGTATACGACTCACTATAGGG
GTCTAGAGACCGGGGTACTTATCAGCCAACCTGTTACAAGGCGCGCTCGCTGGAGGAACGCCAGGCGATG
ATCGCCGCGGTGGCGGGGATCAGTCCGATCGGCCTGCGCCACGATACGCGCGAGACCCATCGTCTGCAGG
CCTGGCCACTGATCGCGCTGCCCGAGGAC
Blast against PA14
BLAST of Processed Sequence against PA14 And PAO1 Genome Sequence
50171 50171 50172 50172 50173 50173 50174 50174
PA14 BLAST Hit ID: 50171       Show Transposon Map
Identities: 94/95 (98.94%) BLAST Bit Score: 180.0 Percent of Processed Sequence That Aligns: 39.33%
Query Start: 105 Query End: 199 Subject Start: 228796 Subject End: 228890 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 228796 PA14_02540*,PA14_02550 -,+
Raw Sequence Start: 228672 PA14_02540*,PA14_02550 -,+
Extrapolated Insert Location: 228792 PA14_02540*,PA14_02550 -,+
Default Offset Location: 228735 PA14_02540*,PA14_02550 -,+
PA14 BLAST Hit ID: 50172       Show Transposon Map
Identities: 21/21 (100.00%) BLAST Bit Score: 42.1 Percent of Processed Sequence That Aligns: 8.37%
Query Start: 219 Query End: 239 Subject Start: 228910 Subject End: 228930 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 228910 PA14_02550 +
Raw Sequence Start: 228672 PA14_02540*,PA14_02550 -,+
Extrapolated Insert Location: 228792 PA14_02540*,PA14_02550 -,+
Default Offset Location: 228735 PA14_02540*,PA14_02550 -,+
PAO1 BLAST Hit ID: 50173       Show Transposon Map
Identities: 91/95 (95.78%) BLAST Bit Score: 157.0 Percent of Processed Sequence That Aligns: 39.33%
Query Start: 105 Query End: 199 Subject Start: 238645 Subject End: 238739 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 238645 PA0208 +
Raw Sequence Start: 238521 PA0208 +
Extrapolated Insert Location: 238641 PA0208 +
Default Offset Location: 238584 PA0208 +
PAO1 BLAST Hit ID: 50174       Show Transposon Map
Identities: 21/21 (100.00%) BLAST Bit Score: 42.1 Percent of Processed Sequence That Aligns: 8.37%
Query Start: 219 Query End: 239 Subject Start: 238759 Subject End: 238779 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 238759 PA0208 +
Raw Sequence Start: 238521 PA0208 +
Extrapolated Insert Location: 238641 PA0208 +
Default Offset Location: 238584 PA0208 +
H PA14 Blast Hit H PAO1 Blast Hit