Mutant Report for Mutant ID: 32052

Strain: PA14 Genetic Background: Wild Type Transposon: MrT7 Library: lib_04_04
Raw Sequence ID: 14772
Chromat Path: H:\Pa14\MrT7\334v1\334v1_G12_G12_098.ab1 Last Transposon Base: 63 Transposon Sequence
Match Quality: 2
Raw Sequence:
(Transposon Sequence in Red)
TGTTCAGTTTGTATACGACTCCTATANGGNTCTAGAGACCGGANACTTATCAGCCAACCTGTTATCTATA
CCCCCGCCCCCCATCCATCTGCAGCCTGCCCAAGANTNNNNNNNANGGNNTTCGCCGAGGTGATGGAGTT
TCTCGTCGAGTCGAAGGTGAACGGCATCGTGATCGGCGGCTCCACCGGCGAGTACTACGCGCACACCGCC
GAGGAACGTCTGGTGCTCGCCTGCCAAGCCAATTAATTCATCTCCGGGCGCCTGCCGTTGGTGGTGTGAA
CCGGCGCGATCCGTACCGAGGATTCGATGGCCTATACCTAACCCTCACTGTGCCATCAGCGTATACGCCA
TCCTGGTCAACTCGCCGCCCTACGCAGTAACCCATCTCGGCGGGAAGATCGCCGAGCATGGGTTGGAGAT
GGACCGCTTCGTCGGCTTGCATATTATGCTCTACCATATCCTTGCGCGGATGGAAGTAGCAGAAAGAAGA
AGCAGTTCTGCAATAGCAGCAACGGTTGCCGCAAAAATCTCGGGGATAGAGGAAAGATAAATATTTACTC
CATAATGCGACCCGTTTTCGTCTGCCTTCTTTCTTCTGATTTTCTTTCTCTTTTGTATGTTTAAATCCAA
TGCCCGGCAGATTTCCCAACATGAAACGAGCGTAATTCCGCCTCTACCCTGAATTCTATTATTCTGTTTG
GGTAAACCCTTACCCCCGCGTTATTATTTGTAGGGGGATTGTGAATGCCATCGCCTTATGCGTTATGCGT
TCTCTATTTCTCCGTTTTTTGCTGCCTGCCCACGAATTATAAAAGAAGCACTATATATTTTCATTATACT
ACGCCCCGTATTTGTCCATATATTAT
Blast against PA14
Processed Seqquence ID: 10334
5' Trim Position: 44 3' Trim Position: 271
Processed Sequence:
(Transposon Sequence in Red)
ACTTATCAGCCAACCTGTTATCTATACCCCCGCCCCCCATCCATCTGCAGCCTGCCCAAGANTNNNNNNN
ANGGNNTTCGCCGAGGTGATGGAGTTTCTCGTCGAGTCGAAGGTGAACGGCATCGTGATCGGCGGCTCCA
CCGGCGAGTACTACGCGCACACCGCCGAGGAACGTCTGGTGCTCGCCTGCCAAGCCAATTAATTCATCTC
CGGGCGCCTGCCGTTGG
Blast against PA14
BLAST of Processed Sequence against PA14 And PAO1 Genome Sequence
47112 47112 47113 47113
PA14 BLAST Hit ID: 47112       Show Transposon Map
Identities: 133/147 (90.47%) BLAST Bit Score: 180.0 Percent of Processed Sequence That Aligns: 64.32%
Query Start: 77 Query End: 223 Subject Start: 837528 Subject End: 837382 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 837528 PA14_09720*,PA14_09730 -,+
Raw Sequence Start: 837648 PA14_09720* -
Extrapolated Insert Location: 837585 PA14_09720*,PA14_09730 -,+
Default Offset Location: 837585 PA14_09720*,PA14_09730 -,+
PAO1 BLAST Hit ID: 47113       Show Transposon Map
Identities: 133/147 (90.47%) BLAST Bit Score: 180.0 Percent of Processed Sequence That Aligns: 64.32%
Query Start: 77 Query End: 223 Subject Start: 4685161 Subject End: 4685307 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 4685161 PA4188 +
Raw Sequence Start: 4685041
Extrapolated Insert Location: 4685104 PA4188 +
Default Offset Location: 4685104 PA4188 +
H PA14 Blast Hit H PAO1 Blast Hit