Mutant Report for Mutant ID: 31937

Strain: PA14 Genetic Background: Wild Type Transposon: MrT7 Library: lib_04_04
Raw Sequence ID: 14657
Chromat Path: H:\Pa14\MrT7\333v1\333v1_F05_F5_045.ab1 Last Transposon Base: 63 Transposon Sequence
Match Quality: 0
Raw Sequence:
(Transposon Sequence in Red)
TGTTCAGTTTGTATACGACTCCTATAGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTACCTGCT
GACCCTGGCGCTGATGCTCGCCATCGTCCCCTGGGACCAGGCCGGGCAGAGCCAGAGCCCGTTCGTCACG
GTGATGCAGGCGATCGGCCTGCCCGGCGCGACCGGCGTGATGAACTTCGTGGTCCTGGTGGCCGCGCTGT
CGGCGATGAACAGCCAGCTCTACATCACCACCCGGATGATGTTCAGCCTGTCGCGCGCGGGGCACGCGCC
GAAGGGCCTCGGCGAACTGAGCCGCCAGGGCGTGCCGCTGAACGCGCTGCTGCTGTCGAGCGTCGGTATC
GCCCTGGCGACCCTGCTCAACCTGGTCTACCCCGAGCAGTCCTTCACCCTGATGATGGCGGTGTCGATGT
TCGGCGCCCTCTTCACCTGGCTGATGATCTTCTTCACCCACCTCTGCTTCCGCCGCCACCGCGCCCGCCA
CGGCGGCGCGCCGCTGGCCTTCCGCATGCGCCTGGCGCCCTGGTCGACATTGCTCGGCCTGGCGCTGATG
GCGGCGATCCTGGTCACCACCTTCTTCACCGAGGCGTTCCGCATGACCTTGGTCTTCGGCGTGCCGTTCC
TCGCGCTGCTCAGCGCACTCTACCTGGTCTTCGTCCGCAAGCCCGGCAAGAATTGTCCGATAGAAAGGGG
CAACGCCCCTATAGCGCTCCCCGCCCTTGCGAATCTTGGCGCGCAAGGTCGAAAGAACGAACCGGTGCAC
CCCTTTCCTGGAACCGGGCGGTTTCCCGTTCCCCCATCCCTTGTTCCGCACAACATAATGGCGAGGCCTG
GGCCAAGCCNCCCTATCCTTCCCGTAAGCGAT
Blast against PA14
Processed Seqquence ID: 10224
5' Trim Position: 3 3' Trim Position: 574
Processed Sequence:
(Transposon Sequence in Red)
TCAGTTTGTATACGACTCCTATAGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTACCTGCTGAC
CCTGGCGCTGATGCTCGCCATCGTCCCCTGGGACCAGGCCGGGCAGAGCCAGAGCCCGTTCGTCACGGTG
ATGCAGGCGATCGGCCTGCCCGGCGCGACCGGCGTGATGAACTTCGTGGTCCTGGTGGCCGCGCTGTCGG
CGATGAACAGCCAGCTCTACATCACCACCCGGATGATGTTCAGCCTGTCGCGCGCGGGGCACGCGCCGAA
GGGCCTCGGCGAACTGAGCCGCCAGGGCGTGCCGCTGAACGCGCTGCTGCTGTCGAGCGTCGGTATCGCC
CTGGCGACCCTGCTCAACCTGGTCTACCCCGAGCAGTCCTTCACCCTGATGATGGCGGTGTCGATGTTCG
GCGCCCTCTTCACCTGGCTGATGATCTTCTTCACCCACCTCTGCTTCCGCCGCCACCGCGCCCGCCACGG
CGGCGCGCCGCTGGCCTTCCGCATGCGCCTGGCGCCCTGGTCGACATTGCTCGGCCTGGCGCTGATGGCG
GCGATCCTGGT
Blast against PA14
BLAST of Processed Sequence against PA14 And PAO1 Genome Sequence
46706 46706 46707 46707 46708 46708 46709 46709 46710 46710 46711 46711
PA14 BLAST Hit ID: 46706       Show Transposon Map
Identities: 512/512 (100.00%) BLAST Bit Score: 999.9 Percent of Processed Sequence That Aligns: 89.49%
Query Start: 60 Query End: 571 Subject Start: 3348216 Subject End: 3348727 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 3348216 PA14_37630,PA14_37620* +,-
Raw Sequence Start: 3348154 PA14_37630,PA14_37620* +,-
Extrapolated Insert Location: 3348217 PA14_37630,PA14_37620* +,-
Default Offset Location: 3348217 PA14_37630,PA14_37620* +,-
PA14 BLAST Hit ID: 46707       Show Transposon Map
Identities: 21/21 (100.00%) BLAST Bit Score: 42.1 Percent of Processed Sequence That Aligns: 3.50%
Query Start: 349 Query End: 369 Subject Start: 405694 Subject End: 405714 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 405694 PA14_04560 +
Raw Sequence Start: 405343 PA14_04560 +
Extrapolated Insert Location: 405406 PA14_04560 +
Default Offset Location: 405406 PA14_04560 +
PA14 BLAST Hit ID: 46708       Show Transposon Map
Identities: 20/20 (100.00%) BLAST Bit Score: 40.1 Percent of Processed Sequence That Aligns: 3.33%
Query Start: 495 Query End: 514 Subject Start: 777907 Subject End: 777926 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 777907 PA14_09170*,PA14_09180 +,-
Raw Sequence Start: 777410 PA14_09170*,PA14_09180 +,-
Extrapolated Insert Location: 777473 PA14_09170*,PA14_09180 +,-
Default Offset Location: 777473 PA14_09170*,PA14_09180 +,-
PAO1 BLAST Hit ID: 46709       Show Transposon Map
Identities: 508/512 (99.21%) BLAST Bit Score: 983.0 Percent of Processed Sequence That Aligns: 89.49%
Query Start: 60 Query End: 571 Subject Start: 2288170 Subject End: 2287659 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 2288170 PA2079 +
Raw Sequence Start: 2288232 PA2079 +
Extrapolated Insert Location: 2288169 PA2079 +
Default Offset Location: 2288169 PA2079 +
PAO1 BLAST Hit ID: 46710       Show Transposon Map
Identities: 21/21 (100.00%) BLAST Bit Score: 42.1 Percent of Processed Sequence That Aligns: 3.50%
Query Start: 349 Query End: 369 Subject Start: 391521 Subject End: 391541 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 391521 PA0348 +
Raw Sequence Start: 391170 PA0348 +
Extrapolated Insert Location: 391233 PA0348 +
Default Offset Location: 391233 PA0348 +
PAO1 BLAST Hit ID: 46711       Show Transposon Map
Identities: 20/20 (100.00%) BLAST Bit Score: 40.1 Percent of Processed Sequence That Aligns: 3.33%
Query Start: 495 Query End: 514 Subject Start: 4748910 Subject End: 4748891 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 4748910 PA4234 -
Raw Sequence Start: 4749407 PA4234 -
Extrapolated Insert Location: 4749344 PA4234 -
Default Offset Location: 4749344 PA4234 -
H PA14 Blast Hit H PAO1 Blast Hit