Mutant Report for Mutant ID: 31822

Strain: PA14 Genetic Background: Wild Type Transposon: MrT7 Library: lib_04_04
Raw Sequence ID: 16750
Chromat Path: H:\Pa14\MrT7\332v1\332v1_D10_D10_090.ab1 Last Transposon Base: 64 Transposon Sequence
Match Quality: 0
Raw Sequence:
(Transposon Sequence in Red)
TGTTCAGTTTGTATACGACTCACTATAGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTACGCAC
ATGGTCGCCAGGCCGCGCCGGCCGCCGCTCTTCTCAAGTTGATGGAGCGCGGTGAGGACCAGCCGCGCAC
CGCTCATCCCCAGCGGGTGGCCGAGGGCGATGGCACCGCCGTTCGGGTTGACCTTCTCACTGTCGTCGGC
CACGCCCAGTTCGCGCAGGCAGGCCAGGCCCTGGCTGGCGAAGGCTTCGTTGAGTTCGATCACGTCGAAG
GCGTCGATCGCCAGGTCCAGGCGCCGCAGCAGCTTGCGCACCGCCGGCACCGGGCCGATGCCCATGATCC
GTGGGGCGACGCCGGCGCTGGCCATGCCCAGCACCCGCGCGCGCGGAGTCAGGCCGTGCTTCTCCACTGC
CTCGGCGGAGGCCAGGACCAGCGCGGCGGCGCCGTCGTTGACCCCGGACGCGTTGCCGGCGGTGACGGTC
TTCTCCGGCCCGTTGACCGGCTTGAGCCGGGCCAGCGCCTCCAGGGTGGTGTCGGGACGCGGATGCTCGT
CGTACTCGACCAGGGTGTCGCCCTTGCGCCCGCGAATCGTCACCGGGACGATTTCCTCGGCGAAGAAACC
GGCCGCCTGCGCCCTGCCGGCGCGCTGCTGGCTGCGCAGGGCGAAGGCATCCTGGTCGGCACGCGACACG
CGATAGTCGTCGGCGACGTTGTCGGCGGTCTGCGGCATCGGGTCGATGCCGTACTGCTCCTTCATCAGCG
GGTTGACGAAGCGCCAGCCGATGGTGGTGTCCTCAATCTTCTGGCCGCGCCCGAGAGCGCTATCGGCCTT
TGCCATCACGTACGGGGCGCGCGAAATTCTATTCGACCCCTCCAGGAATGGCCAGCTCCT
Blast against PA14
Processed Seqquence ID: 11860
5' Trim Position: 4 3' Trim Position: 743
Processed Sequence:
(Transposon Sequence in Red)
CAGTTTGTATACGACTCACTATAGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTACGCACATGG
TCGCCAGGCCGCGCCGGCCGCCGCTCTTCTCAAGTTGATGGAGCGCGGTGAGGACCAGCCGCGCACCGCT
CATCCCCAGCGGGTGGCCGAGGGCGATGGCACCGCCGTTCGGGTTGACCTTCTCACTGTCGTCGGCCACG
CCCAGTTCGCGCAGGCAGGCCAGGCCCTGGCTGGCGAAGGCTTCGTTGAGTTCGATCACGTCGAAGGCGT
CGATCGCCAGGTCCAGGCGCCGCAGCAGCTTGCGCACCGCCGGCACCGGGCCGATGCCCATGATCCGTGG
GGCGACGCCGGCGCTGGCCATGCCCAGCACCCGCGCGCGCGGAGTCAGGCCGTGCTTCTCCACTGCCTCG
GCGGAGGCCAGGACCAGCGCGGCGGCGCCGTCGTTGACCCCGGACGCGTTGCCGGCGGTGACGGTCTTCT
CCGGCCCGTTGACCGGCTTGAGCCGGGCCAGCGCCTCCAGGGTGGTGTCGGGACGCGGATGCTCGTCGTA
CTCGACCAGGGTGTCGCCCTTGCGCCCGCGAATCGTCACCGGGACGATTTCCTCGGCGAAGAAACCGGCC
GCCTGCGCCCTGCCGGCGCGCTGCTGGCTGCGCAGGGCGAAGGCATCCTGGTCGGCACGCGACACGCGAT
AGTCGTCGGCGACGTTGTCGGCGGTCTGCGGCATCGGGT
Blast against PA14
BLAST of Processed Sequence against PA14 And PAO1 Genome Sequence
53593 53593 53594 53594 53595 53595 53596 53596 53597 53597 53598 53598 53599 53599 53600 53600 53601 53601 53602 53602 53603 53603 53604 53604 53605 53605 53606 53606 53607 53607 53608 53608 53609 53609 53610 53610 53611 53611 53612 53612 53613 53613 53614 53614
PA14 BLAST Hit ID: 53593       Show Transposon Map
Identities: 680/680 (100.00%) BLAST Bit Score: 999.9 Percent of Processed Sequence That Aligns: 91.88%
Query Start: 60 Query End: 739 Subject Start: 248422 Subject End: 247743 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 248422 PA14_02780*,PA14_02790 +,-
Raw Sequence Start: 248485 PA14_02780* +
Extrapolated Insert Location: 248421 PA14_02780*,PA14_02790 +,-
Default Offset Location: 248422 PA14_02780*,PA14_02790 +,-
PA14 BLAST Hit ID: 53594       Show Transposon Map
Identities: 42/46 (91.30%) BLAST Bit Score: 60.0 Percent of Processed Sequence That Aligns: 6.09%
Query Start: 438 Query End: 483 Subject Start: 3446355 Subject End: 3446400 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 3446355 PA14_38630,PA14_38620* -,+
Raw Sequence Start: 3445914 PA14_38620* +
Extrapolated Insert Location: 3445978 PA14_38630,PA14_38620* -,+
Default Offset Location: 3445977 PA14_38630,PA14_38620* -,+
PA14 BLAST Hit ID: 53595       Show Transposon Map
Identities: 25/25 (100.00%) BLAST Bit Score: 50.1 Percent of Processed Sequence That Aligns: 3.25%
Query Start: 429 Query End: 453 Subject Start: 2741620 Subject End: 2741596 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 2741620 PA14_31530,PA14_31520* -,+
Raw Sequence Start: 2742052 PA14_31520* +
Extrapolated Insert Location: 2741988 PA14_31530,PA14_31520* -,+
Default Offset Location: 2741989 PA14_31530,PA14_31520* -,+
PA14 BLAST Hit ID: 53596       Show Transposon Map
Identities: 39/44 (88.63%) BLAST Bit Score: 48.1 Percent of Processed Sequence That Aligns: 5.82%
Query Start: 325 Query End: 368 Subject Start: 3446242 Subject End: 3446285 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 3446242 PA14_38630,PA14_38620* -,+
Raw Sequence Start: 3445914 PA14_38620* +
Extrapolated Insert Location: 3445978 PA14_38630,PA14_38620* -,+
Default Offset Location: 3445977 PA14_38630,PA14_38620* -,+
PA14 BLAST Hit ID: 53597       Show Transposon Map
Identities: 30/32 (93.75%) BLAST Bit Score: 48.1 Percent of Processed Sequence That Aligns: 4.19%
Query Start: 448 Query End: 479 Subject Start: 1535604 Subject End: 1535573 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 1535604 PA14_17870*,PA14_17880 +,-
Raw Sequence Start: 1536055 PA14_17870* +
Extrapolated Insert Location: 1535991 PA14_17870*,PA14_17880 +,-
Default Offset Location: 1535992 PA14_17870*,PA14_17880 +,-
PA14 BLAST Hit ID: 53598       Show Transposon Map
Identities: 23/23 (100.00%) BLAST Bit Score: 46.1 Percent of Processed Sequence That Aligns: 2.98%
Query Start: 243 Query End: 265 Subject Start: 2195875 Subject End: 2195853 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 2195875 PA14_25070*,PA14_25090 +,-
Raw Sequence Start: 2196121 PA14_25070* +
Extrapolated Insert Location: 2196057 PA14_25070*,PA14_25090 +,-
Default Offset Location: 2196058 PA14_25070*,PA14_25090 +,-
PA14 BLAST Hit ID: 53599       Show Transposon Map
Identities: 21/21 (100.00%) BLAST Bit Score: 42.1 Percent of Processed Sequence That Aligns: 2.71%
Query Start: 243 Query End: 263 Subject Start: 1681487 Subject End: 1681467 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 1681487 PA14_19420*,PA14_19430 +,-
Raw Sequence Start: 1681733 PA14_19420* +
Extrapolated Insert Location: 1681669 PA14_19420*,PA14_19430 +,-
Default Offset Location: 1681670 PA14_19420*,PA14_19430 +,-
PA14 BLAST Hit ID: 53600       Show Transposon Map
Identities: 30/33 (90.90%) BLAST Bit Score: 42.1 Percent of Processed Sequence That Aligns: 4.33%
Query Start: 649 Query End: 681 Subject Start: 1681051 Subject End: 1681019 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 1681051 PA14_19420*,PA14_19430 +,-
Raw Sequence Start: 1681703 PA14_19420*,PA14_19430 +,-
Extrapolated Insert Location: 1681639 PA14_19420*,PA14_19430 +,-
Default Offset Location: 1681640 PA14_19420*,PA14_19430 +,-
PA14 BLAST Hit ID: 53601       Show Transposon Map
Identities: 27/29 (93.10%) BLAST Bit Score: 42.1 Percent of Processed Sequence That Aligns: 3.79%
Query Start: 148 Query End: 176 Subject Start: 1535904 Subject End: 1535876 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 1535904 PA14_17870*,PA14_17880 +,-
Raw Sequence Start: 1536055 PA14_17870* +
Extrapolated Insert Location: 1535991 PA14_17870*,PA14_17880 +,-
Default Offset Location: 1535992 PA14_17870*,PA14_17880 +,-
PA14 BLAST Hit ID: 53602       Show Transposon Map
Identities: 24/25 (96.00%) BLAST Bit Score: 42.1 Percent of Processed Sequence That Aligns: 3.25%
Query Start: 429 Query End: 453 Subject Start: 1123368 Subject End: 1123392 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 1123368 PA14_13080*,PA14_13090 +,-
Raw Sequence Start: 1122936 PA14_13080* +
Extrapolated Insert Location: 1123000 PA14_13080*,PA14_13090 +,-
Default Offset Location: 1122999 PA14_13080*,PA14_13090 +,-
PA14 BLAST Hit ID: 53603       Show Transposon Map
Identities: 29/32 (90.62%) BLAST Bit Score: 40.1 Percent of Processed Sequence That Aligns: 4.19%
Query Start: 148 Query End: 179 Subject Start: 3754749 Subject End: 3754780 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 3754749 PA14_42090 -
Raw Sequence Start: 3754598 PA14_42080,PA14_42070* -,+
Extrapolated Insert Location: 3754662 PA14_42090 -
Default Offset Location: 3754661 PA14_42090 -
PAO1 BLAST Hit ID: 53604       Show Transposon Map
Identities: 678/680 (99.70%) BLAST Bit Score: 999.9 Percent of Processed Sequence That Aligns: 91.88%
Query Start: 60 Query End: 739 Subject Start: 258271 Subject End: 257592 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 258271 PA0228 -
Raw Sequence Start: 258334
Extrapolated Insert Location: 258270 PA0228 -
Default Offset Location: 258271 PA0228 -
PAO1 BLAST Hit ID: 53605       Show Transposon Map
Identities: 42/46 (91.30%) BLAST Bit Score: 60.0 Percent of Processed Sequence That Aligns: 6.09%
Query Start: 438 Query End: 483 Subject Start: 2187832 Subject End: 2187787 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 2187832 PA2001 -
Raw Sequence Start: 2188273
Extrapolated Insert Location: 2188209 PA2001 -
Default Offset Location: 2188210 PA2001 -
PAO1 BLAST Hit ID: 53606       Show Transposon Map
Identities: 25/25 (100.00%) BLAST Bit Score: 50.1 Percent of Processed Sequence That Aligns: 3.25%
Query Start: 429 Query End: 453 Subject Start: 2885769 Subject End: 2885793 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 2885769 PA2553 -
Raw Sequence Start: 2885337
Extrapolated Insert Location: 2885401 PA2553 -
Default Offset Location: 2885400 PA2553 -
PAO1 BLAST Hit ID: 53607       Show Transposon Map
Identities: 39/44 (88.63%) BLAST Bit Score: 48.1 Percent of Processed Sequence That Aligns: 5.82%
Query Start: 325 Query End: 368 Subject Start: 2187945 Subject End: 2187902 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 2187945 PA2001 -
Raw Sequence Start: 2188273
Extrapolated Insert Location: 2188209 PA2001 -
Default Offset Location: 2188210 PA2001 -
PAO1 BLAST Hit ID: 53608       Show Transposon Map
Identities: 23/23 (100.00%) BLAST Bit Score: 46.1 Percent of Processed Sequence That Aligns: 2.98%
Query Start: 243 Query End: 265 Subject Start: 3373481 Subject End: 3373503 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 3373481 PA3013 -
Raw Sequence Start: 3373235
Extrapolated Insert Location: 3373299 PA3013 -
Default Offset Location: 3373298 PA3013 -
PAO1 BLAST Hit ID: 53609       Show Transposon Map
Identities: 22/22 (100.00%) BLAST Bit Score: 44.1 Percent of Processed Sequence That Aligns: 2.84%
Query Start: 238 Query End: 259 Subject Start: 3296195 Subject End: 3296216 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 3296195 PA2940 -
Raw Sequence Start: 3295954
Extrapolated Insert Location: 3296018 PA2940 -
Default Offset Location: 3296017 PA2940 -
PAO1 BLAST Hit ID: 53610       Show Transposon Map
Identities: 28/30 (93.33%) BLAST Bit Score: 44.1 Percent of Processed Sequence That Aligns: 3.92%
Query Start: 150 Query End: 179 Subject Start: 2188114 Subject End: 2188085 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 2188114 PA2001 -
Raw Sequence Start: 2188267
Extrapolated Insert Location: 2188203 PA2001 -
Default Offset Location: 2188204 PA2001 -
PAO1 BLAST Hit ID: 53611       Show Transposon Map
Identities: 24/25 (96.00%) BLAST Bit Score: 42.1 Percent of Processed Sequence That Aligns: 3.25%
Query Start: 429 Query End: 453 Subject Start: 4400892 Subject End: 4400868 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 4400892 PA3925 -
Raw Sequence Start: 4401324
Extrapolated Insert Location: 4401260 PA3925 -
Default Offset Location: 4401261 PA3925 -
PAO1 BLAST Hit ID: 53612       Show Transposon Map
Identities: 21/21 (100.00%) BLAST Bit Score: 42.1 Percent of Processed Sequence That Aligns: 2.71%
Query Start: 243 Query End: 263 Subject Start: 3859559 Subject End: 3859579 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 3859559 PA3454 -
Raw Sequence Start: 3859313
Extrapolated Insert Location: 3859377 PA3454 -
Default Offset Location: 3859376 PA3454 -
PAO1 BLAST Hit ID: 53613       Show Transposon Map
Identities: 39/45 (86.66%) BLAST Bit Score: 42.1 Percent of Processed Sequence That Aligns: 5.95%
Query Start: 150 Query End: 194 Subject Start: 3373385 Subject End: 3373429 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 3373385 PA3013 -
Raw Sequence Start: 3373232
Extrapolated Insert Location: 3373296 PA3013 -
Default Offset Location: 3373295 PA3013 -
PAO1 BLAST Hit ID: 53614       Show Transposon Map
Identities: 29/32 (90.62%) BLAST Bit Score: 40.1 Percent of Processed Sequence That Aligns: 4.19%
Query Start: 148 Query End: 179 Subject Start: 1880055 Subject End: 1880024 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 1880055 PA1736 -
Raw Sequence Start: 1880206 PA1737 -
Extrapolated Insert Location: 1880142 PA1736 -
Default Offset Location: 1880143 PA1736 -
H PA14 Blast Hit H PAO1 Blast Hit