Mutant Report for Mutant ID: 31744

Strain: PA14 Genetic Background: Wild Type Transposon: MrT7 Library: lib_04_04
Raw Sequence ID: 16672
Chromat Path: H:\Pa14\MrT7\331v1\331v1_F04_F4_042.ab1 Last Transposon Base: Transposon Sequence
Match Quality:
Raw Sequence:
(Transposon Sequence in Red)
TTATCCGCAACCTGTTACATCGCCCAGCCGTCGATCTCCACGGCGGTGAAGGGTCTGGAGGAAAGCTTCG
GCGTGCAGCTGTTCATCCGCCACCACGCCCAGGGCGTGTCGCTGACCCCCGCCGGCGCGCGCTTCTACCG
CAAGGCCCAGGAGCTGCTGCGGATGGCCCACGAGTTCGAGCAGAACGCCCTGGCCGACAACGACGTGATC
GCCGGGCAGATCGACATCGGCTGCTTCGAGACGGTCGCCCCGCTCTACCTGCCGGGCCTGATCGCCGGCT
TTCGCCAGGCCTATCCGGGGGTGGAGATCCGCATCCGCGACGGCGAGCAGCAGGAACTGGTGCAAGGCCT
CACCTCGGGGCGCTTCGACCTGGACTTCCTCTACGAGCACGACCTCGACTCGACCATCGAGACCGAGCCG
CTGATGCCGCCGCAACGACCCCACGGGCTGCTCCCCGAAGGCCACCGCTTCGCCGGGCATGCGCAAGTGT
CGCTGCGCGACCTGTGACTGGAAACCGATGATCCTGCTCGACGTGCAGCCCAACCACACCTAATATCGCC
AAACTGTTCGGTTACGAAACTGTAAATAACGTATAATCCTATCGTAGGTTTCCACCGTATTGCAACACAG
TTAGGTTTCTTACCATTTATATCATTTTTCTTATCTGAATAATCCTCCTTTATTATGATTAAGGATACCG
ATCTAATGCAGATAATACGTCTTACGTCTATTACAACTTATCGAAATAGCTATACCAAAAATTATATCAT
CATTATAATACAATATCTATATTAATATCTTAGCCATTCTCACCCAGATGCACGAAAACAATATATCTCC
ACTGCCTAAGATTTTATAATGTCATATACTGAGAGATAAACGAN
Blast against PA14
Processed Seqquence ID: 11794
5' Trim Position: 8 3' Trim Position: 470
Processed Sequence:
(Transposon Sequence in Red)
AACCTGTTACATCGCCCAGCCGTCGATCTCCACGGCGGTGAAGGGTCTGGAGGAAAGCTTCGGCGTGCAG
CTGTTCATCCGCCACCACGCCCAGGGCGTGTCGCTGACCCCCGCCGGCGCGCGCTTCTACCGCAAGGCCC
AGGAGCTGCTGCGGATGGCCCACGAGTTCGAGCAGAACGCCCTGGCCGACAACGACGTGATCGCCGGGCA
GATCGACATCGGCTGCTTCGAGACGGTCGCCCCGCTCTACCTGCCGGGCCTGATCGCCGGCTTTCGCCAG
GCCTATCCGGGGGTGGAGATCCGCATCCGCGACGGCGAGCAGCAGGAACTGGTGCAAGGCCTCACCTCGG
GGCGCTTCGACCTGGACTTCCTCTACGAGCACGACCTCGACTCGACCATCGAGACCGAGCCGCTGATGCC
GCCGCAACGACCCCACGGGCTGCTCCCCGAAGGCCACCGCTT
Blast against PA14
BLAST of Processed Sequence against PA14 And PAO1 Genome Sequence
53263 53263 53264 53264
PA14 BLAST Hit ID: 53263       Show Transposon Map
Identities: 453/455 (99.56%) BLAST Bit Score: 886.0 Percent of Processed Sequence That Aligns: 98.27%
Query Start: 8 Query End: 462 Subject Start: 236935 Subject End: 236481 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 236935 PA14_02660 +
Raw Sequence Start: 236950 PA14_02660 +
Extrapolated Insert Location:
Default Offset Location: 236887 PA14_02660 +
PAO1 BLAST Hit ID: 53264       Show Transposon Map
Identities: 447/455 (98.24%) BLAST Bit Score: 839.0 Percent of Processed Sequence That Aligns: 98.27%
Query Start: 8 Query End: 462 Subject Start: 246784 Subject End: 246330 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 246784 PA0218 +
Raw Sequence Start: 246799 PA0218 +
Extrapolated Insert Location:
Default Offset Location: 246736 PA0218 +
H PA14 Blast Hit H PAO1 Blast Hit