Mutant Report for Mutant ID: 31657

Strain: PA14 Genetic Background: Wild Type Transposon: MrT7 Library: lib_04_04
Raw Sequence ID: 16585
Chromat Path: H:\Pa14\MrT7\330v1\330v1_G01_G1_006.ab1 Last Transposon Base: Transposon Sequence
Match Quality:
Raw Sequence:
(Transposon Sequence in Red)
TTTTTTTTTTTTCTTTTCTTTTCTTTTTATTCCCCTTTCCTTTCCTCTCCTACNGGGNGAANNNCCTGTT
CAGTTTGTATACGACTCACTATAGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTACAGCCTGGC
GCAGAAGAGCGCGTTCCGCGTCATCGTCCATCCCTCCGCCGCGCATCATGTGGGGGCCTGGCCACGCAAC
GTGAAGGAGGCGTCCTGACATGGCCTTCTCGACCCAGGACAGCGACGAAGTCCTTTCCGAAATCAACGTC
ACCCCGCTGGTCGACGTGATGCTGGAGCTGCTGGTGGAGTTTATATTCACCGCGCCGCTGCTGACCAACT
CGATCCCGATCAATCTGCCAAAGACCGAATCGGTGGCGCCGCCGGAGACGAAGGATCCCCTGGTGGAAAG
CATCAAACTCGGCCTTCATAACTGTTCATAGAAGAGAGAATGATGATCACAAAAGCGAACTCGACTGGAA
AGACAATTTGTGTTGCTTATCTTTAGCATATATGACTCACTAATATACCCCGTAGATAGCTCGCTAGGTC
CACTCCTATATGTCTCCTCACTTTATACTCAGCTATGGGAGCGTCTTCATAAGTATACATTGTTAATCTA
CTTATTCCTAAAAATTAAGAATGTGTGTATTCATCCCAATAGCGTATTGTTATAGTAGTAATCTATACCG
TGTGTCGTGTGGCATGTGAAGCACTCAGTCATACTCTCAGACAAAGACGCATGTACGTCTCTGGAGACGT
CTCTTCGTTCATTTGTTTACTTTGATAATTTTACAAAATCTGAATGCTATAATTTGTAAATCGTCATATC
CTATATTCTCATCACTATAGAACTAAGATTATAATATAACGAGATACAAACGAACTGGTTGATACCGTCG
CTTATTATACTGTCTCCATCTCACCTCCCGGAGGNAGTTCGAGTGAAGCGCGCGATCACTCTATCATAAG
TGAATAGTATGGCTGCCCCTGTACATGCAGACGGACTCACATTATAAGATGCCTCGGGAGAAACGAATTC
ACTCACACATACTCCACACGTTACTACTCACGATTCGGTTCAGTGGCGGAGGCGCGCATCTCGTCCGGTT
CCTTGAGTAGTCTGCTTCACTGATGCGCCATTAGCTTCATATGAACTCGCTACTACTCTACCTCGAACGC
GTCCTGCTGGGACACCAATGATGAGTTTCGCTCATGTTCACGCTTTATCTTATGCTCCACTGCGAGCCTG
GAGTCGCGTGATGACATATACATGATTCACTTGCTTCTTGGGCGCGGCATGTGGTGCGTGATGTGGCACG
CN
Blast against PA14
Processed Seqquence ID: 11729
5' Trim Position: 71 3' Trim Position: 361
Processed Sequence:
(Transposon Sequence in Red)
AGTTTGTATACGACTCACTATAGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTACAGCCTGGCG
CAGAAGAGCGCGTTCCGCGTCATCGTCCATCCCTCCGCCGCGCATCATGTGGGGGCCTGGCCACGCAACG
TGAAGGAGGCGTCCTGACATGGCCTTCTCGACCCAGGACAGCGACGAAGTCCTTTCCGAAATCAACGTCA
CCCCGCTGGTCGACGTGATGCTGGAGCTGCTGGTGGAGTTTATATTCACCGCGCCGCTGCTGACCAACTC
GATCCCGATC
Blast against PA14
BLAST of Processed Sequence against PA14 And PAO1 Genome Sequence
53024 53024 53025 53025 53026 53026 53027 53027 53028 53028 53029 53029
PA14 BLAST Hit ID: 53024       Show Transposon Map
Identities: 152/157 (96.81%) BLAST Bit Score: 272.0 Percent of Processed Sequence That Aligns: 53.79%
Query Start: 134 Query End: 290 Subject Start: 225656 Subject End: 225812 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 225656 PA14_02500 +
Raw Sequence Start: 225452 PA14_02480*,PA14_02500 -,+
Extrapolated Insert Location:
Default Offset Location: 225515 PA14_02500 +
PA14 BLAST Hit ID: 53025       Show Transposon Map
Identities: 55/55 (100.00%) BLAST Bit Score: 109.0 Percent of Processed Sequence That Aligns: 18.62%
Query Start: 59 Query End: 113 Subject Start: 225581 Subject End: 225635 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 225581 PA14_02500 +
Raw Sequence Start: 225452 PA14_02480*,PA14_02500 -,+
Extrapolated Insert Location:
Default Offset Location: 225515 PA14_02500 +
PA14 BLAST Hit ID: 53026       Show Transposon Map
Identities: 39/45 (86.66%) BLAST Bit Score: 42.1 Percent of Processed Sequence That Aligns: 15.17%
Query Start: 201 Query End: 245 Subject Start: 4913170 Subject End: 4913126 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 4913170 PA14_55340 +
Raw Sequence Start: 4913441 PA14_55350*,PA14_55360 -,+
Extrapolated Insert Location:
Default Offset Location: 4913378 PA14_55350*,PA14_55360 -,+
PAO1 BLAST Hit ID: 53027       Show Transposon Map
Identities: 152/157 (96.81%) BLAST Bit Score: 272.0 Percent of Processed Sequence That Aligns: 53.79%
Query Start: 134 Query End: 290 Subject Start: 228919 Subject End: 229075 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 228919 PA0198 +
Raw Sequence Start: 228715 PA0198 +
Extrapolated Insert Location:
Default Offset Location: 228778 PA0198 +
PAO1 BLAST Hit ID: 53028       Show Transposon Map
Identities: 55/55 (100.00%) BLAST Bit Score: 109.0 Percent of Processed Sequence That Aligns: 18.62%
Query Start: 59 Query End: 113 Subject Start: 228844 Subject End: 228898 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 228844 PA0198 +
Raw Sequence Start: 228715 PA0198 +
Extrapolated Insert Location:
Default Offset Location: 228778 PA0198 +
PAO1 BLAST Hit ID: 53029       Show Transposon Map
Identities: 39/45 (86.66%) BLAST Bit Score: 42.1 Percent of Processed Sequence That Aligns: 15.17%
Query Start: 201 Query End: 245 Subject Start: 767227 Subject End: 767271 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 767227 PA0694 +
Raw Sequence Start: 766956 PA0693 +
Extrapolated Insert Location:
Default Offset Location: 767019 PA0693 +
H PA14 Blast Hit H PAO1 Blast Hit