Mutant Report for Mutant ID: 31642

Strain: PA14 Genetic Background: Wild Type Transposon: MrT7 Library: lib_04_04
Raw Sequence ID: 16570
Chromat Path: H:\Pa14\MrT7\330v1\330v1_E10_E10_083.ab1 Last Transposon Base: 64 Transposon Sequence
Match Quality: 0
Raw Sequence:
(Transposon Sequence in Red)
TGTTCAGTTTGTATACGACTCACTATAGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTACGTGC
GCCAGGACCACGATACCAGCCGCTACCATCATCTGCAGGCCTGGCCAGCGCTGGGCTTCCGCTTCCTCGC
GTCCAGCGGGGTGGTCGACCTGGTCCAGCCGGTGCTCGACGGGCTCGCCCGGGAGACCGGCGAACTGGTG
CGCCTGGGGGTGATCGAAGGCGATCGCCAGACCTGGATCGCCAAGTCCCAGGGCGCCACCTCCGGGCTAC
GCTACGACCCCGACATGGGGCGCGAGGCGCCGCTGTTCTATACCGCGTCCGGGCATCATCTGCAGGCCTG
GCCAGATNTTATGGCTTTCCCTCTCTTTGGTTGTAGCTTCATGGCAATAGAGTCAGTCTGGTTACTTTCA
GTCCCAAACGAGACGAACTATATAAGATTATACTATGATGCTATTAACTGTACATCCCAATCCCGAACTG
CTCTCATTTTTACATTTGTACATTCATTATGGCTCCTCTTCTACCGCGCATCAGTCGCATATCGTCCTCG
ACCGTTTCTTTATGTTACTCGCTCTCCTATTTCAGAACCGTTTCTATGTATTCTTCGTAGATGGATAGTA
ATCATGTTAGATATATAGGTTACTACCGTAATGGCCTTTTGGCTCTTCTGTTCTCTGGTTATGTGTCCTA
TCATCTGTGGTGGTGCATTATCTGAGTCTTATGTATGTTACGTGCATCATCTGCAACTGGCACTTCACTA
ATCCTTATTCCGCTTACTCCATATACACACACTCTATTCTTCTATCACCTCTCGCGATTTCTCAACATCA
CACCTAGCTGCCGCCGAGTGTTCTTAACATCCCAGTGAATGTTCATGAACTGTCTAACCTTTTACAACAT
ATTGTATTTATACACTATATTTTGTTTTCTATTCAGTCAAAGTACACCTATGTCATAACTTTGCGTGTTA
TGTATACACATTCAAGCGTACACGTATACGAATACGAGGATAAGATCAGTGTACCTTACGAATATGACCA
AGAGCTCTCACCTGCGCACGTCTTGTTCATTTCGCTAGTCCTATACTATAATATATTCTCTCTCAGCCGT
GTGCTTCGTTCTCTGACGCGGTGTATGCCTACCN
Blast against PA14
Processed Seqquence ID: 11716
5' Trim Position: 3 3' Trim Position: 355
Processed Sequence:
(Transposon Sequence in Red)
TCAGTTTGTATACGACTCACTATAGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTACGTGCGCC
AGGACCACGATACCAGCCGCTACCATCATCTGCAGGCCTGGCCAGCGCTGGGCTTCCGCTTCCTCGCGTC
CAGCGGGGTGGTCGACCTGGTCCAGCCGGTGCTCGACGGGCTCGCCCGGGAGACCGGCGAACTGGTGCGC
CTGGGGGTGATCGAAGGCGATCGCCAGACCTGGATCGCCAAGTCCCAGGGCGCCACCTCCGGGCTACGCT
ACGACCCCGACATGGGGCGCGAGGCGCCGCTGTTCTATACCGCGTCCGGGCATCATCTGCAGGCCTGGCC
AG
Blast against PA14
BLAST of Processed Sequence against PA14 And PAO1 Genome Sequence
52964 52964 52965 52965
PA14 BLAST Hit ID: 52964       Show Transposon Map
Identities: 264/274 (96.35%) BLAST Bit Score: 442.0 Percent of Processed Sequence That Aligns: 76.99%
Query Start: 61 Query End: 332 Subject Start: 256566 Subject End: 256837 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 256566 PA14_02910 +
Raw Sequence Start: 256503 PA14_02910 +
Extrapolated Insert Location: 256567 PA14_02910 +
Default Offset Location: 256566 PA14_02910 +
PAO1 BLAST Hit ID: 52965       Show Transposon Map
Identities: 261/274 (95.25%) BLAST Bit Score: 418.0 Percent of Processed Sequence That Aligns: 76.99%
Query Start: 61 Query End: 332 Subject Start: 266766 Subject End: 267037 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 266766 PA0236 +
Raw Sequence Start: 266703 PA0236 +
Extrapolated Insert Location: 266767 PA0236 +
Default Offset Location: 266766 PA0236 +
H PA14 Blast Hit H PAO1 Blast Hit