Mutant Report for Mutant ID: 31335

Strain: PA14 Genetic Background: Wild Type Transposon: MrT7 Library: lib_04_04
Raw Sequence ID: 16263
Chromat Path: H:\Pa14\MrT7\327v1\327v1_D03_D3_028.ab1 Last Transposon Base: Transposon Sequence
Match Quality:
Raw Sequence:
(Transposon Sequence in Red)
NNNNNNNNNNTTTTNNNNNNNNNNNTTTTNNNNNNNTTTTNNNTTTNNNNCNNNNNNTTTNNTTNNNNNN
NNNNNNTNTTTTNNCTTGTCCAGTTTTGTAATACGACTCACTATAGGGGTCTAGAGACCGGGGACTTATC
AGCCAATCTGTTATAACGTCGACCGCTCGGCGTCGAAGAAGTACACCGCGCCGCTGCTGGATACGCCGAA
GACCGTCACCGTGATCCCGTAACAGGTGATCAAGGACACTGGCGCCCTGACCCTGGTCGACGCACTGCGC
ACCATCCCGGGTATCATCTTCGGCGCGGGTGAGGGCGGTAACCCCGCTGGCGACCGGCCATTCATCCGTG
GCTTCAACGCCGAGAGTGATACTTTCCTCGACGGTGTTGCGTGACGTCTACTCACTAACCTCGCGATGTG
TTCATCGTCGTAGATGATCGGGGTCAGATTGGGTGCTGGTTCGGTCTACTCCGGCGGCGGCTCCACCGGT
GGCCGCCAGAACTTGATCGTGAAGACCGGCAAGTTGGAGATCTTCACCCAATCTAGCTTCATCGGGGGAT
CTGATTAAAACCCGAACGCATTAGTCTAGACAGCAACCCCGGACCAATAGGGGAGAAACGCCGCCATCAG
CGAAAACCTATAAGAAGGATGATAACTAAGGTCGCAGGGTTGTAGCAAGAACAATGTATTGTTTATTGTG
ACCGCAGGCGGCTCACCCTTCTACCCCTACAAAGATCAACCAGCGGTCAAAACAGTAAGGTGCCTTGGTG
GTTTGTAACACATGTTAGACGCCGAATGGTAGACTAGAGATACCCAATTTTCCAACTTATCGAGAGCTAT
AAAAAATGATAAAAAATTCAAAATAGTGCTAACGCTAGAAGGTACAATAATAAAAAAACAATATAATTAA
TGTAATCTATGTTCTCTAATAAAAATAAAATATAAACAGTTAGATAAGAATCTGTCAAATTGGACGGAAC
TATACAATGTTAACCATAACCTAAAGAAGAATATAAACC
Blast against PA14
Processed Seqquence ID: 11476
5' Trim Position: 108 3' Trim Position: 355
Processed Sequence:
(Transposon Sequence in Red)
CACTATAGGGGTCTAGAGACCGGGGACTTATCAGCCAATCTGTTATAACGTCGACCGCTCGGCGTCGAAG
AAGTACACCGCGCCGCTGCTGGATACGCCGAAGACCGTCACCGTGATCCCGTAACAGGTGATCAAGGACA
CTGGCGCCCTGACCCTGGTCGACGCACTGCGCACCATCCCGGGTATCATCTTCGGCGCGGGTGAGGGCGG
TAACCCCGCTGGCGACCGGCCATTCATCCGTGGCTTC
Blast against PA14
BLAST of Processed Sequence against PA14 And PAO1 Genome Sequence
51990 51990 51991 51991 51992 51992 51993 51993
PA14 BLAST Hit ID: 51990       Show Transposon Map
Identities: 197/204 (96.56%) BLAST Bit Score: 349.0 Percent of Processed Sequence That Aligns: 82.19%
Query Start: 44 Query End: 247 Subject Start: 5219388 Subject End: 5219185 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 5219388 PA14_58570 +
Raw Sequence Start: 5219539 PA14_58570 +
Extrapolated Insert Location:
Default Offset Location: 5219476 PA14_58570 +
PA14 BLAST Hit ID: 51991       Show Transposon Map
Identities: 53/62 (85.48%) BLAST Bit Score: 52.0 Percent of Processed Sequence That Aligns: 24.70%
Query Start: 50 Query End: 111 Subject Start: 4201296 Subject End: 4201235 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 4201296 PA14_47140 +
Raw Sequence Start: 4201453 PA14_47140 +
Extrapolated Insert Location:
Default Offset Location: 4201390 PA14_47140 +
PAO1 BLAST Hit ID: 51992       Show Transposon Map
Identities: 195/204 (95.58%) BLAST Bit Score: 333.0 Percent of Processed Sequence That Aligns: 82.19%
Query Start: 44 Query End: 247 Subject Start: 5055681 Subject End: 5055478 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 5055681 PA4514 +
Raw Sequence Start: 5055832 PA4514 +
Extrapolated Insert Location:
Default Offset Location: 5055769 PA4514 +
PAO1 BLAST Hit ID: 51993       Show Transposon Map
Identities: 74/89 (83.14%) BLAST Bit Score: 58.0 Percent of Processed Sequence That Aligns: 35.63%
Query Start: 50 Query End: 138 Subject Start: 1433337 Subject End: 1433425 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 1433337 PA1322 +
Raw Sequence Start: 1433180 PA1322 +
Extrapolated Insert Location:
Default Offset Location: 1433243 PA1322 +
H PA14 Blast Hit H PAO1 Blast Hit