Mutant Report for Mutant ID: 30343

Strain: PA14 Genetic Background: Wild Type Transposon: MrT7 Library: lib_04_04
Raw Sequence ID: 14119
Chromat Path: H:\Pa14\MrT7\317v1\317v1_A07_A7_053.ab1 Last Transposon Base: 117 Transposon Sequence
Match Quality: 3
Raw Sequence:
(Transposon Sequence in Red)
GGAAGGGGGAGTGGGAGAGGGGGCTGAGGGTGCGAGCAGGANNNTAANNANNTTGTTCAGTTTGCTAACG
NATCAGTATAGGGGTCTAGAGAGCGGAGAATTATCAGCCAACCTGTTAGATGGATCTCGACACTCATGCG
CTGACTCCCCGTCTCTGCGGGCCTGGCCACTGGAGGATCTTGCGTCCCTTCACCACCACGTTCTTGTCGG
CCTTGATGTTGATCGCCCCGGATCCGTCGACGGTGGGGCTGTTGAGGCTGAAGACGGTGCTGCCGACCTT
CTTGATGCGGAGGTGGCGGAACGGGGTGACGAGGGGGTACAGATAGTCCGTATTAAATGAGAATCTCTAT
GATCACGTACAATATAACGTATTTGGAGAAATGATGTTATGTGATGGGGAGATAAGGAACTTTGTTTTGT
TGATTCTGTTGTTGGCGTTTCGTTGTGTTTGCGTGTTATGGGTTTAGTGAGCTGTTATTAGGGTAACGTT
GTGCTCATCTTCTTATCCTTTTGCTAGTGAGCAGGGAAGTACGAAATGAACGATATAAGTTGTTTTATTG
GTGCTAGTCTAACCTGCAGGGCCGTTTCTGCTCCTCTTTCGGCCAGATCACGGCTGCTCGCTGTCATTTT
AGTTTTTAGGCTTGGTACAAAGCACGGTGCGCCCTAGCCAGTCAGTGACGCGGAGATCAGGTGTCTAAAT
GTTAAGTGTGTCGGTATGATTAGATGTAGCTAAAAGCAAAATAATACAACACACAACATAAAGCGCTAAA
CTAATTCGATTATTGACGGATATGATATAGTAAAATAGTATAAGCTGTATTATATAATATTTGCTTAGTA
TTTGAGTCTGTTAGGTGTCCGTGAGGTTTCTATGCTTCGAGACTATCTACGTCTCGCGTCTATGCGTTTC
TTGCTGCTTGCTAGGGTATGGGTGAGGGTATTTGATGTGGTTCGGAATGAATTATTAGTTGATCAGTACG
GTTGTGTAAGACGAAGTTGGGAGCGTGAGCGCTTCAAAGTCTTATTGAAGTTTGATGGATGGGAGTTTGT
ATTGGCCCAGCGCAACAAGGTGAGCGACAGAGTGTCGGTACACTATGGTTTCGGGTTGTAATGTCGAGTA
TAGCTCGTTGTGATAATTAGTAGTTTTTGTTTAAGTTTGTTCGGAGTAGAGT
Blast against PA14
Processed Seqquence ID: 9778
5' Trim Position: 95 3' Trim Position: 237
Processed Sequence:
(Transposon Sequence in Red)
GAGAATTATCAGCCAACCTGTTAGATGGATCTCGACACTCATGCGCTGACTCCCCGTCTCTGCGGGCCTG
GCCACTGGAGGATCTTGCGTCCCTTCACCACCACGTTCTTGTCGGCCTTGATGTTGATCGCCCCGGATCC
GT
Blast against PA14
BLAST of Processed Sequence against PA14 And PAO1 Genome Sequence
44570 44570 44571 44571
PA14 BLAST Hit ID: 44570       Show Transposon Map
Identities: 112/122 (91.80%) BLAST Bit Score: 155.0 Percent of Processed Sequence That Aligns: 84.51%
Query Start: 22 Query End: 142 Subject Start: 115554 Subject End: 115433 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 115554 PA14_01170 -
Raw Sequence Start: 115670 PA14_01170 -
Extrapolated Insert Location: 115553 PA14_01170 -
Default Offset Location: 115607 PA14_01170 -
PAO1 BLAST Hit ID: 44571       Show Transposon Map
Identities: 111/122 (90.98%) BLAST Bit Score: 147.0 Percent of Processed Sequence That Aligns: 84.51%
Query Start: 22 Query End: 142 Subject Start: 117572 Subject End: 117451 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 117572 PA0096 -
Raw Sequence Start: 117688 PA0096 -
Extrapolated Insert Location: 117571 PA0096 -
Default Offset Location: 117625 PA0096 -
H PA14 Blast Hit H PAO1 Blast Hit