Mutant Report for Mutant ID: 30077

Strain: PA14 Genetic Background: Wild Type Transposon: MrT7 Library: lib_04_04
Raw Sequence ID: 13853
Chromat Path: H:\Pa14\MrT7\314v1\314v1_C05_C5_038.ab1 Last Transposon Base: 120 Transposon Sequence
Match Quality: 3
Raw Sequence:
(Transposon Sequence in Red)
NNNNNNNGGGGGGGGGGGNGNNGGGGGNGGGGGGNANNNNNAANNNCAAAAAAANNNAATGTTCAGTTTG
TATACGACTCACTATAGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTAGCCGCCCATGCTCTCG
AACACCTTGGCGGCCTGCAGGTCGCGGCTTTCCTGGGTGAACAGGTCGACCTCGAGGATGCTGCGGATGA
CTTCTGGCTCGGCGCCGTCCACCAGCAGTTGCAGGCCCTTGCACGCATAGGGATCTGGCTCCGCGTCGGC
GATGCTCTCCAGGCCGAGCAGGCCTTCCTTGCGCGCGGTCATGCTCCAGGAGACAATCCGGTCGATTCCC
CCGGAAAGATCCTCGCGCGGCGGGAAGAACTCCCTGCCGAGCTTGCCCAGGCCGCGCTTGATCACGTTCA
CCGGGGTCCGCAACAGCGCCGCGGACAAGGTGCCGCCGATCACGATCAACGCCGCCGGATCGTTGAGCAG
GGCCCCCGCGTGGCCGCCCTCGAGGAAGATGCCGCCGACAATGGCTACGAACGCCAGGATGATCCCGACC
ATGTTGAGCACATCCATCAGTGCGTCTCCTCAATGTCGGAGAAAGTGCGCGGCAGTCGTCACGTGTGAGG
CCTATTTAAGGTCGTCTTCGCCTCTCAAACTCCACGCGTACTTTCCCCCCATGACCAGATGCCGGCACAT
TGAAAACCATGCTCGTACTCCAAATGCACCTATGTTTGATTTACAACCCAGACATAGGCATTCCCGTAAA
TTCAGATATATGTTGCCTCATACAGAAAACTAAAACTGGTTTGCCCTCCTGCGTTGAACGACAGTAATAT
GGCTTAAGAGAAAGGTCTGGGTTCCATAGGACAATAAAAAACATCTTGATAAAAACTATTTCGATTTGTT
AGTCCCTTGAATCCACTAACCCAAACAATACATGGCAAAAAAAAAAAATGGTAGTGTAAGAAAACACCAT
ATCGAGTAAAAGAAATATATTGCTG
Blast against PA14
Processed Seqquence ID: 9558
5' Trim Position: 72 3' Trim Position: 368
Processed Sequence:
(Transposon Sequence in Red)
TACGACTCACTATAGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTAGCCGCCCATGCTCTCGAA
CACCTTGGCGGCCTGCAGGTCGCGGCTTTCCTGGGTGAACAGGTCGACCTCGAGGATGCTGCGGATGACT
TCTGGCTCGGCGCCGTCCACCAGCAGTTGCAGGCCCTTGCACGCATAGGGATCTGGCTCCGCGTCGGCGA
TGCTCTCCAGGCCGAGCAGGCCTTCCTTGCGCGCGGTCATGCTCCAGGAGACAATCCGGTCGATTCCCCC
GGAAAGATCCTCGCGC
Blast against PA14
BLAST of Processed Sequence against PA14 And PAO1 Genome Sequence
43689 43689 43690 43690 43691 43691 43692 43692
PA14 BLAST Hit ID: 43689       Show Transposon Map
Identities: 243/246 (98.78%) BLAST Bit Score: 464.0 Percent of Processed Sequence That Aligns: 82.77%
Query Start: 51 Query End: 296 Subject Start: 4053227 Subject End: 4053472 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 4053227 PA14_45560,PA14_45530* -,+
Raw Sequence Start: 4053105 PA14_45560,PA14_45530* -,+
Extrapolated Insert Location: 4053225 PA14_45560,PA14_45530* -,+
Default Offset Location: 4053168 PA14_45560,PA14_45530* -,+
PA14 BLAST Hit ID: 43690       Show Transposon Map
Identities: 21/21 (100.00%) BLAST Bit Score: 42.1 Percent of Processed Sequence That Aligns: 6.76%
Query Start: 202 Query End: 222 Subject Start: 5074827 Subject End: 5074847 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 5074827 PA14_56940 -
Raw Sequence Start: 5074554 PA14_56940 -
Extrapolated Insert Location: 5074674 PA14_56940 -
Default Offset Location: 5074617 PA14_56940 -
PAO1 BLAST Hit ID: 43691       Show Transposon Map
Identities: 240/246 (97.56%) BLAST Bit Score: 440.0 Percent of Processed Sequence That Aligns: 82.77%
Query Start: 51 Query End: 296 Subject Start: 1590987 Subject End: 1590742 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 1590987 PA1460 -
Raw Sequence Start: 1591109 PA1460 -
Extrapolated Insert Location: 1590989 PA1460 -
Default Offset Location: 1591046 PA1460 -
PAO1 BLAST Hit ID: 43692       Show Transposon Map
Identities: 21/21 (100.00%) BLAST Bit Score: 42.1 Percent of Processed Sequence That Aligns: 6.76%
Query Start: 202 Query End: 222 Subject Start: 4911274 Subject End: 4911294 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 4911274 PA4380 -
Raw Sequence Start: 4911001 PA4380 -
Extrapolated Insert Location: 4911121 PA4380 -
Default Offset Location: 4911064 PA4380 -
H PA14 Blast Hit H PAO1 Blast Hit