Mutant Report for Mutant ID: 29777

Strain: PA14 Genetic Background: Wild Type Transposon: MrT7 Library: lib_04_04
Raw Sequence ID: 13553
Chromat Path: H:\Pa14\MrT7\311v1\311v1_B05_B5_045.ab1 Last Transposon Base: 31 Transposon Sequence
Match Quality: 0
Raw Sequence:
(Transposon Sequence in Red)
TGGCGACCGGGGACTTATCAGCCAACCTGTTAACTGCCAGCCCGGCGGCGATGGACATGCCGCCGAAGCA
GCCGACCGGCCCGGCGATCACCGCCACCACCGGCTGGTAGCGCTGCAGATCGACGATGGCCGCCTGGATC
TCGGCGATCGCCGCCAGTCCGAGGTTGGCTTCCTGCAGGCGCACGCCACCGGTTTCCAGCAACAGCAGGG
CCCGGGTCGGAACGCCGTTGCGGTTGTCCTCGGCGGCCAGCTCCAGCGCGCCGGCGATCTTCGCTCCGCT
GACCTCGCCAAGGCTGCCGCCCTGGAAGGCACCTTCGATGGCGGCGAGCACCGCCGGCTGGCCGTCGAGC
AGGCCACGGGCGACCACTACCCCATCGTCGGCCTGGGGCACGATGCCCTGTCGTTCCAACCAGGGTGACT
GCACGCCGGCGAAGGGATCGAGCAACTCGCGGAAGCTGCCCGCGTCGAGCAAGGCACGGGCGCGTTGGCG
CGCTCCCAGTTCGGTGAAGCTGCGCAGCGCCAGCTGGCGGGCGACGTCAGTCATGGCCAGCCTCCTCCAG
TGCCTGCTCCGGGCGCATGCGGACCCCCCCTGGAGTGGCGCCGAAATCCTGAATGCGGATCGACGCGGCC
GGGCGCCTTGAACCCCGCAAAAACCCGCCGCGGAAAGTTGTTGGCAGCGCGGGCCGCTTGCGTTTTTCAA
GGGCACCACCTGGATACTCCCCCCCCTACCGGGGGCAGCCTGGCACGACCTCAGGTGAACGGAGGTGGGG
GGTCAGTACAGTAGGGACCAACAACATGACCGCGGGAGAAAATTCGAAGGGGGAGTCTCAATTTATGGAC
ATTCACCCCCCCCG
Blast against PA14
Processed Seqquence ID: 9289
5' Trim Position: 7 3' Trim Position: 503
Processed Sequence:
(Transposon Sequence in Red)
CGGGGACTTATCAGCCAACCTGTTAACTGCCAGCCCGGCGGCGATGGACATGCCGCCGAAGCAGCCGACC
GGCCCGGCGATCACCGCCACCACCGGCTGGTAGCGCTGCAGATCGACGATGGCCGCCTGGATCTCGGCGA
TCGCCGCCAGTCCGAGGTTGGCTTCCTGCAGGCGCACGCCACCGGTTTCCAGCAACAGCAGGGCCCGGGT
CGGAACGCCGTTGCGGTTGTCCTCGGCGGCCAGCTCCAGCGCGCCGGCGATCTTCGCTCCGCTGACCTCG
CCAAGGCTGCCGCCCTGGAAGGCACCTTCGATGGCGGCGAGCACCGCCGGCTGGCCGTCGAGCAGGCCAC
GGGCGACCACTACCCCATCGTCGGCCTGGGGCACGATGCCCTGTCGTTCCAACCAGGGTGACTGCACGCC
GGCGAAGGGATCGAGCAACTCGCGGAAGCTGCCCGCGTCGAGCAAGGCACGGGCGCGTTGGCGCGCTCCC
AGTTCG
Blast against PA14
BLAST of Processed Sequence against PA14 And PAO1 Genome Sequence
42272 42272 42273 42273 42274 42274 42275 42275 42276 42276 42277 42277 42278 42278 42279 42279
PA14 BLAST Hit ID: 42272       Show Transposon Map
Identities: 464/466 (99.57%) BLAST Bit Score: 908.0 Percent of Processed Sequence That Aligns: 93.75%
Query Start: 31 Query End: 496 Subject Start: 230728 Subject End: 230263 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 230728 PA14_02580 -
Raw Sequence Start: 230765 PA14_02580 -
Extrapolated Insert Location: 230734 PA14_02580 -
Default Offset Location: 230702 PA14_02580 -
PA14 BLAST Hit ID: 42273       Show Transposon Map
Identities: 24/25 (96.00%) BLAST Bit Score: 42.1 Percent of Processed Sequence That Aligns: 4.84%
Query Start: 30 Query End: 54 Subject Start: 833796 Subject End: 833772 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 833796 PA14_09690 -
Raw Sequence Start: 833832
Extrapolated Insert Location: 833801 PA14_09690 -
Default Offset Location: 833769 PA14_09690 -
PA14 BLAST Hit ID: 42274       Show Transposon Map
Identities: 20/20 (100.00%) BLAST Bit Score: 40.1 Percent of Processed Sequence That Aligns: 3.83%
Query Start: 76 Query End: 95 Subject Start: 3399818 Subject End: 3399837 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 3399818 PA14_38100*,PA14_38110 +,-
Raw Sequence Start: 3399736 PA14_38100*,PA14_38110 +,-
Extrapolated Insert Location: 3399767 PA14_38100*,PA14_38110 +,-
Default Offset Location: 3399799 PA14_38100*,PA14_38110 +,-
PA14 BLAST Hit ID: 42275       Show Transposon Map
Identities: 20/20 (100.00%) BLAST Bit Score: 40.1 Percent of Processed Sequence That Aligns: 3.83%
Query Start: 418 Query End: 437 Subject Start: 429074 Subject End: 429093 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 429074 PA14_04860 -
Raw Sequence Start: 428650
Extrapolated Insert Location: 428681
Default Offset Location: 428713 PA14_04860 -
PAO1 BLAST Hit ID: 42276       Show Transposon Map
Identities: 457/466 (98.06%) BLAST Bit Score: 852.0 Percent of Processed Sequence That Aligns: 93.75%
Query Start: 31 Query End: 496 Subject Start: 240577 Subject End: 240112 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 240577 PA0211 -
Raw Sequence Start: 240614 PA0211 -
Extrapolated Insert Location: 240583 PA0211 -
Default Offset Location: 240551 PA0211 -
PAO1 BLAST Hit ID: 42277       Show Transposon Map
Identities: 24/25 (96.00%) BLAST Bit Score: 42.1 Percent of Processed Sequence That Aligns: 4.84%
Query Start: 30 Query End: 54 Subject Start: 4693143 Subject End: 4693167 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 4693143 PA4196 -
Raw Sequence Start: 4693107
Extrapolated Insert Location: 4693138 PA4196 -
Default Offset Location: 4693170 PA4196 -
PAO1 BLAST Hit ID: 42278       Show Transposon Map
Identities: 20/20 (100.00%) BLAST Bit Score: 40.1 Percent of Processed Sequence That Aligns: 3.83%
Query Start: 76 Query End: 95 Subject Start: 2234382 Subject End: 2234363 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 2234382 PA2042 -
Raw Sequence Start: 2234464 PA2042 -
Extrapolated Insert Location: 2234433 PA2042 -
Default Offset Location: 2234401 PA2042 -
PAO1 BLAST Hit ID: 42279       Show Transposon Map
Identities: 20/20 (100.00%) BLAST Bit Score: 40.1 Percent of Processed Sequence That Aligns: 3.83%
Query Start: 418 Query End: 437 Subject Start: 414326 Subject End: 414345 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 414326 PA0370 -
Raw Sequence Start: 413902
Extrapolated Insert Location: 413933
Default Offset Location: 413965 PA0370 -
H PA14 Blast Hit H PAO1 Blast Hit