Mutant Report for Mutant ID: 29618

Strain: PA14 Genetic Background: Wild Type Transposon: MrT7 Library: lib_09_03
Raw Sequence ID: 13394
Chromat Path: H:\Pa14\MrT7\309v1\309v1_E02_E2_017.ab1 Last Transposon Base: 120 Transposon Sequence
Match Quality: 3
Raw Sequence:
(Transposon Sequence in Red)
NNNNNNNNNNNNNNNNNNNNNTTTTNTTTTTTTTTNTTTTNNNNNTNTNTTTTTTNNGGTGTTCAGTTTG
TATACGACTCACTATAGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTATTCCGCTACTGGCTGC
AGGGCGGACGGATCGACGTCGGCTTCCTCGGCGCGGCCCAGGTCGACCGCTTCGGCAACATCAACACCAC
CGTGATCGGCGACTACCGCCAGCCCAAGGTGCGCCTGCCGGGAGCCGGCGGCGCGCCGGAAATCGCCGGC
AGCGCCAAGGAAGTGCTGATCATCCTCAAGCAGTCGCACCGCACCTTCGTCGACAAGCTGGCCTTCGTCA
CCTCGGTCGGCCATGGCGAGGGCGGCGACTCGCGCCAGCGCCTGGGCCTGCCGGGCAAGGGGCCGGTGGC
GATCATCACCGACCTGTGCATCATGGAGCCGGAAGCCGGCAGCAACGAGTTCGTGGTCACTTCTCTGCAT
CCGGGCGTGACCCGCGAGCAGGTGGTCGAGGCCACCCGGTTGGGCGAACCGCTTCTCCGAGCGGGTCGCC
GAGACGCCCGCGCCGAACGAGGTCAAACTCGCCGCGCTGCGCGACCTTCTAGGCGCGCACCGCGGCCGCC
CATTGGACAGAAGGGGAGCGACCAATGAACCCGCGAGGTAATCCACCTGCCATGCCCTTGAGCACGCACA
ATCGGACGTTTTCTGGCGAAGTCCTTTCCCGCTGGAGTGCCCCGAACAAACTCCTCGGATGTGCCCCCTA
AAAGACCTTGGTTATAACGCTAACCCAGGGGTTCAAATTGTCCGGTCCCTGGAACAAGGTGTACCCTCGG
GTGGCCGCAACCAAGGCTGGGAAGATATAACCTTTAACGATGGTCTTCAATGACGCCGCCCGCTTGGCCC
GCTTTACACAAAAAAGTAGCCCCGGGTATCAACCTTAAACCGCATATTGGCTCCTTAGGGAGAGAAAGCC
CT
Blast against PA14
Processed Seqquence ID: 9135
5' Trim Position: 68 3' Trim Position: 505
Processed Sequence:
(Transposon Sequence in Red)
TGTATACGACTCACTATAGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTATTCCGCTACTGGCT
GCAGGGCGGACGGATCGACGTCGGCTTCCTCGGCGCGGCCCAGGTCGACCGCTTCGGCAACATCAACACC
ACCGTGATCGGCGACTACCGCCAGCCCAAGGTGCGCCTGCCGGGAGCCGGCGGCGCGCCGGAAATCGCCG
GCAGCGCCAAGGAAGTGCTGATCATCCTCAAGCAGTCGCACCGCACCTTCGTCGACAAGCTGGCCTTCGT
CACCTCGGTCGGCCATGGCGAGGGCGGCGACTCGCGCCAGCGCCTGGGCCTGCCGGGCAAGGGGCCGGTG
GCGATCATCACCGACCTGTGCATCATGGAGCCGGAAGCCGGCAGCAACGAGTTCGTGGTCACTTCTCTGC
ATCCGGGCGTGACCCGC
Blast against PA14
BLAST of Processed Sequence against PA14 And PAO1 Genome Sequence
41495 41495 41496 41496
PA14 BLAST Hit ID: 41495       Show Transposon Map
Identities: 382/383 (99.73%) BLAST Bit Score: 751.0 Percent of Processed Sequence That Aligns: 87.41%
Query Start: 55 Query End: 437 Subject Start: 246730 Subject End: 247112 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 246730 PA14_02770 +
Raw Sequence Start: 246608 PA14_02770 +
Extrapolated Insert Location: 246728 PA14_02770 +
Default Offset Location: 246671 PA14_02770 +
PAO1 BLAST Hit ID: 41496       Show Transposon Map
Identities: 379/381 (99.47%) BLAST Bit Score: 739.0 Percent of Processed Sequence That Aligns: 86.96%
Query Start: 57 Query End: 437 Subject Start: 256581 Subject End: 256961 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 256581 PA0227 +
Raw Sequence Start: 256457 PA0227 +
Extrapolated Insert Location: 256577 PA0227 +
Default Offset Location: 256520 PA0227 +
H PA14 Blast Hit H PAO1 Blast Hit