Mutant Report for Mutant ID: 29303

Strain: PA14 Genetic Background: Wild Type Transposon: MrT7 Library: lib_09_03
Raw Sequence ID: 13079
Chromat Path: H:\Pa14\MrT7\306v1\306v1_B11_B11_091.ab1 Last Transposon Base: Transposon Sequence
Match Quality:
Raw Sequence:
(Transposon Sequence in Red)
TTTTNNNNNNNNNNNNNNNNNCCCTTTTTTTTTTTTNTTTNNNNTTTTNNNTNNNNTNTNNNNNNTTGTT
CAGTTTGTATACGACTCACTATAGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTAGGCATCGAA
CAACTGGTTGGCGGGGACGTCGCTCATCGGTTTTCCTTTTCCCGGCCCGTCAGGGCTCGTCGTTCAGGTA
GCTGACCTTGCGCAGATCCGGCAGGCTCACGCAAACCATCAGCTTGAGAAGGGGCAAGGCTGATACATAC
CAGCAGAAGACGTTCTCCATCCCTCCCGACTTCATCCACAGGGCGAATTTCTAGGCCGAGCCTTCAAATA
CCGCGTTGCCCACTGTGTAGGACACTTTCTACGCCGATTGCGCGCTGTTCCGGTGGTAACTTCTCGGCCT
TGATCTCGTCTCTTTTGGAAGTGTACTCCCCTGATCATGGTCCCCGTTGGTGATGTTTTGTAGAACGGCC
TTGATACGTATTGCTCACTGTATTCAACGATTAAAGGACCAGCAAATACTATTATAGTGCCCAGGTTGCT
TAACCAAAATATTATTTATTTTACGTTTAATGATATACAAAAACATCCATACCACTTGCGGCATCAGCTT
GCTCTTAAAAAATATAAATCTCCCCCCGGCGTGCCAGGTTTTTTTACGCATCGTTGCTGATGATGACCAT
ATATATTCATTAACCACCTGGTACACTACTTGTAACATCCCCTACCCTCCAAAATAATAATTAAATACCC
TGAAAAACAAAAACTACTTTACAACATAAAACACTTTCGTTTCACCTTTCCATTTAATTCCCCACCTCCA
TAATTATCCATTAAAATGCCTAAAACTCTCAACAATATTCTCCGATAAATTAAATATTTACGTGATAACA
GAAACACCCCCATACGGACAACCAAACCGGGCCCATTCCCGAGCCAG
Blast against PA14
Processed Seqquence ID: 8854
5' Trim Position: 73 3' Trim Position: 311
Processed Sequence:
(Transposon Sequence in Red)
TTTGTATACGACTCACTATAGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTAGGCATCGAACAA
CTGGTTGGCGGGGACGTCGCTCATCGGTTTTCCTTTTCCCGGCCCGTCAGGGCTCGTCGTTCAGGTAGCT
GACCTTGCGCAGATCCGGCAGGCTCACGCAAACCATCAGCTTGAGAAGGGGCAAGGCTGATACATACCAG
CAGAAGACGTTCTCCATCCCTCCCGACT
Blast against PA14
BLAST of Processed Sequence against PA14 And PAO1 Genome Sequence
39861 39861 39862 39862 39863 39863 39864 39864
PA14 BLAST Hit ID: 39861       Show Transposon Map
Identities: 169/182 (92.85%) BLAST Bit Score: 258.0 Percent of Processed Sequence That Aligns: 76.05%
Query Start: 57 Query End: 238 Subject Start: 249972 Subject End: 249791 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 249972 PA14_02820*,PA14_02830 +,-
Raw Sequence Start: 250101 PA14_02820*,PA14_02830 +,-
Extrapolated Insert Location:
Default Offset Location: 250038 PA14_02820*,PA14_02830 +,-
PA14 BLAST Hit ID: 39862       Show Transposon Map
Identities: 20/20 (100.00%) BLAST Bit Score: 40.1 Percent of Processed Sequence That Aligns: 7.98%
Query Start: 61 Query End: 80 Subject Start: 2081998 Subject End: 2082017 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 2081998 PA14_23940*,PA14_23960*,PA14_23970 -,+,-
Raw Sequence Start: 2081865 PA14_23940*,PA14_23950 -,+
Extrapolated Insert Location:
Default Offset Location: 2081928 PA14_23940* -
PAO1 BLAST Hit ID: 39863       Show Transposon Map
Identities: 168/182 (92.30%) BLAST Bit Score: 250.0 Percent of Processed Sequence That Aligns: 76.05%
Query Start: 57 Query End: 238 Subject Start: 259821 Subject End: 259640 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 259821 PA0230 -
Raw Sequence Start: 259950 PA0230 -
Extrapolated Insert Location:
Default Offset Location: 259887 PA0230 -
PAO1 BLAST Hit ID: 39864       Show Transposon Map
Identities: 20/20 (100.00%) BLAST Bit Score: 40.1 Percent of Processed Sequence That Aligns: 7.98%
Query Start: 61 Query End: 80 Subject Start: 3486291 Subject End: 3486272 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 3486291 PA3105 -
Raw Sequence Start: 3486424 PA3106 +
Extrapolated Insert Location:
Default Offset Location: 3486361
H PA14 Blast Hit H PAO1 Blast Hit