Mutant Report for Mutant ID: 29066

Strain: PA14 Genetic Background: Wild Type Transposon: MrT7 Library: lib_09_03
Raw Sequence ID: 12842
Chromat Path: H:\Pa14\MrT7\303v1\303v1_G02_G2_019.ab1 Last Transposon Base: 60 Transposon Sequence
Match Quality: 0
Raw Sequence:
(Transposon Sequence in Red)
CCGTTTGTATACGACTCACTATAGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTAGCCCGGCAG
CAGGCCGCCGAGGATCGCCCCGACCGAGCCGCAGCCGTTGACGAAGCCGGTGGCGGTGCCGGCCGCCTCG
CTGGTGCCGAAGTCGATGGCGGCGGCGCCGCTGATCATCGAGTCCGGCCCGTAGAGGGTGACGCCCTTCT
TGTGCGGGCTGGCCACCTTTTTGTTTTGTTAGTCATTTTTAGATAACTTAACATAAACTTATTAAAGAGA
AAGGGCCAGATACTGTTTTTTAAAATTATTAGATAATGAAAAAAATGATAATTTAACGATATGATAGAGG
GGGGAAAGAATTGTTTATGTTTAGAGGGTTTTTTAAATATTTTAATACATTTATTTATATTTCTTTTGTT
TTTATTGGTGTTTGTGGCGTAAGTTAGGATTTTGATTAAATGTGTCGTGTATGAATTCTTTAATGGCGGG
TATATTTTTATATATGATTTTTATGGGACAATGTGATTTGAAACTGCTATTTACTCAGAGATTTTAATGT
GTTTTTGGGAATTTTTTTCGATTGTATGTCCACTCCGTGTTTAGTAGTTTTGTTGTTGTGATCCATGCGT
TCGTAGTAAGTGGTGTTATCAAAGAGGGGAGTTGTTGGTGTGCGTTTTGTGCTTATAATAACCGAAGGAG
GGCCGCTTCATTGTATTCTGGTATGGTAGTGGGGTGAACAGGCAATTTTTTGAGAGGATGAAATGATGTT
AAAGACAATAGACATTCAGAACAGGTAAGGAAAGGCAGCGCTTGAGCTGTGATATGCATTATGTATAGAG
AGGTTGCGGGTAATAAGAGAAAGGTAGGTGCGTCGAGCAAAAAACAGATAAAAAA
Blast against PA14
Processed Seqquence ID: 8629
5' Trim Position: 3 3' Trim Position: 198
Processed Sequence:
(Transposon Sequence in Red)
TTTGTATACGACTCACTATAGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTAGCCCGGCAGCAG
GCCGCCGAGGATCGCCCCGACCGAGCCGCAGCCGTTGACGAAGCCGGTGGCGGTGCCGGCCGCCTCGCTG
GTGCCGAAGTCGATGGCGGCGGCGCCGCTGATCATCGAGTCCGGCCCGTAGAGGG
Blast against PA14
BLAST of Processed Sequence against PA14 And PAO1 Genome Sequence
38921 38921 38922 38922 38923 38923 38924 38924 38925 38925 38926 38926
PA14 BLAST Hit ID: 38921       Show Transposon Map
Identities: 139/139 (100.00%) BLAST Bit Score: 276.0 Percent of Processed Sequence That Aligns: 70.77%
Query Start: 57 Query End: 195 Subject Start: 4414959 Subject End: 4414821 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 4414959 PA14_49610,PA14_49600* -,+
Raw Sequence Start: 4415018 PA14_49610,PA14_49600* -,+
Extrapolated Insert Location: 4414958 PA14_49610,PA14_49600* -,+
Default Offset Location: 4414955 PA14_49610,PA14_49600* -,+
PA14 BLAST Hit ID: 38922       Show Transposon Map
Identities: 126/139 (90.64%) BLAST Bit Score: 172.0 Percent of Processed Sequence That Aligns: 70.77%
Query Start: 57 Query End: 195 Subject Start: 3933549 Subject End: 3933411 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 3933549 PA14_44190 -
Raw Sequence Start: 3933608 PA14_44190 -
Extrapolated Insert Location: 3933548 PA14_44190 -
Default Offset Location: 3933545 PA14_44190 -
PA14 BLAST Hit ID: 38923       Show Transposon Map
Identities: 23/24 (95.83%) BLAST Bit Score: 40.1 Percent of Processed Sequence That Aligns: 11.79%
Query Start: 110 Query End: 133 Subject Start: 6166283 Subject End: 6166260 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 6166283 PA14_69120*,PA14_69130 +,-
Raw Sequence Start: 6166395 PA14_69130 -
Extrapolated Insert Location: 6166335 PA14_69120*,PA14_69130 +,-
Default Offset Location: 6166332 PA14_69120*,PA14_69130 +,-
PAO1 BLAST Hit ID: 38924       Show Transposon Map
Identities: 135/139 (97.12%) BLAST Bit Score: 244.0 Percent of Processed Sequence That Aligns: 70.77%
Query Start: 57 Query End: 195 Subject Start: 1234973 Subject End: 1235111 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 1234973 PA1144 -
Raw Sequence Start: 1234914 PA1144 -
Extrapolated Insert Location: 1234974 PA1144 -
Default Offset Location: 1234977 PA1144 -
PAO1 BLAST Hit ID: 38925       Show Transposon Map
Identities: 126/139 (90.64%) BLAST Bit Score: 172.0 Percent of Processed Sequence That Aligns: 70.77%
Query Start: 57 Query End: 195 Subject Start: 1709975 Subject End: 1710113 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 1709975 PA1569 -
Raw Sequence Start: 1709916 PA1569 -
Extrapolated Insert Location: 1709976 PA1569 -
Default Offset Location: 1709979 PA1569 -
PAO1 BLAST Hit ID: 38926       Show Transposon Map
Identities: 23/24 (95.83%) BLAST Bit Score: 40.1 Percent of Processed Sequence That Aligns: 11.79%
Query Start: 110 Query End: 133 Subject Start: 5894069 Subject End: 5894046 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 5894069 PA5235 -
Raw Sequence Start: 5894181 PA5235 -
Extrapolated Insert Location: 5894121 PA5235 -
Default Offset Location: 5894118 PA5235 -
H PA14 Blast Hit H PAO1 Blast Hit