Mutant Report for Mutant ID: 29044

Strain: PA14 Genetic Background: Wild Type Transposon: MrT7 Library: lib_09_03
Raw Sequence ID: 12820
Chromat Path: H:\Pa14\MrT7\303v1\303v1_E04_E4_035.ab1 Last Transposon Base: 25 Transposon Sequence
Match Quality: 1
Raw Sequence:
(Transposon Sequence in Red)
CCGGGGACTTATCAGCCAACCTGTTACATCGAGCCGCTGTTCACCCGCGACCCGCGCCACATCAAGCCGG
TCCACGTGCTGATGGCGATGATGGCGATCCGCGGCATCTACCAGCGGCACAACGTGCAGTCGCTGAACCA
CGGCATCGGCTTCAACACCGCGGCCATCGAGCTGATCCTGCCGACCTACGGCGAGTCCCTCGGCCTGAAG
GGCAAGATCTGCCGGCACTGGACCCTCAACCCGCACCCGATCCTTTTCACCGCGTACGAGGGGGGGTGGG
GCGGAAAGCCGTTTCTTGCTTCCACACCAAGATGAAAATTTAGTTTTCTTTCTATTAACATCTCTACTTT
TTCTTTTCCTTGTTCGTCTTTATTCGTTTTTTCCATGAATTTTCTTGTTTTTTGGTCCAGGTGGTACGTG
GTAATACTTGTTTTTTCGCTCTTCCCTTTTGGTTCGATGGATTTTAATATCCCCCCCACTGACACATTGT
TTTTGTCTTGTACGATTTTAGTGTCCTTTTTATGTTTATTTCTCCTCACTGCGTCTGTGCCCCCATTAGT
GTGGCATTTTATATCTGCGGCGCGGACCCTTACACTTTCCTTAAGTCATCTTTGATATTTCTCGTATTTT
TGTCTTATTTTTTGGTAAGTGTACAAATTTATCTTAGTTAAATCTTTTATGAAGTTATATAAGAGAGCCA
CCTATAACGGTTTACGTGTGTACTGTATTATGATAGTTGTCTAGACCACTTTTTATTGTACACCTGTAAA
AGCTTCTCCCCCCATACCGTTATTATTCCATAAAATACCACCCGGTTTATGTTCTGCCTAGTAGTAACAA
AACTGTACACAATCCGCCCACAAA
Blast against PA14
Processed Seqquence ID: 8608
5' Trim Position: 1 3' Trim Position: 248
Processed Sequence:
(Transposon Sequence in Red)
CGGGGACTTATCAGCCAACCTGTTACATCGAGCCGCTGTTCACCCGCGACCCGCGCCACATCAAGCCGGT
CCACGTGCTGATGGCGATGATGGCGATCCGCGGCATCTACCAGCGGCACAACGTGCAGTCGCTGAACCAC
GGCATCGGCTTCAACACCGCGGCCATCGAGCTGATCCTGCCGACCTACGGCGAGTCCCTCGGCCTGAAGG
GCAAGATCTGCCGGCACTGGACCCTCAACCCGCACCC
Blast against PA14
BLAST of Processed Sequence against PA14 And PAO1 Genome Sequence
38807 38807 38808 38808 38809 38809
PA14 BLAST Hit ID: 38807       Show Transposon Map
Identities: 224/224 (100.00%) BLAST Bit Score: 444.0 Percent of Processed Sequence That Aligns: 90.28%
Query Start: 24 Query End: 247 Subject Start: 228043 Subject End: 228266 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 228043 PA14_02540*,PA14_02550 -,+
Raw Sequence Start: 228019 PA14_02540*,PA14_02550 -,+
Extrapolated Insert Location: 228044 PA14_02540*,PA14_02550 -,+
Default Offset Location: 228082 PA14_02540*,PA14_02550 -,+
PAO1 BLAST Hit ID: 38808       Show Transposon Map
Identities: 223/224 (99.55%) BLAST Bit Score: 436.0 Percent of Processed Sequence That Aligns: 90.28%
Query Start: 24 Query End: 247 Subject Start: 237892 Subject End: 238115 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 237892 PA0208 +
Raw Sequence Start: 237868 PA0208 +
Extrapolated Insert Location: 237893 PA0208 +
Default Offset Location: 237931 PA0208 +
PAO1 BLAST Hit ID: 38809       Show Transposon Map
Identities: 26/28 (92.85%) BLAST Bit Score: 40.1 Percent of Processed Sequence That Aligns: 10.93%
Query Start: 65 Query End: 92 Subject Start: 2452693 Subject End: 2452720 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 2452693 PA2230 +
Raw Sequence Start: 2452628 PA2230 +
Extrapolated Insert Location: 2452653 PA2230 +
Default Offset Location: 2452691 PA2230 +
H PA14 Blast Hit H PAO1 Blast Hit