Mutant Report for Mutant ID: 28999

Strain: PA14 Genetic Background: Wild Type Transposon: MrT7 Library: lib_09_03
Raw Sequence ID: 12775
Chromat Path: H:\Pa14\MrT7\303v1\303v1_A07_A7_053.ab1 Last Transposon Base: Transposon Sequence
Match Quality:
Raw Sequence:
(Transposon Sequence in Red)
NNNNNAACCCCNAACCNNNNNNNAATTTNNNNNNNNNNNAAAAAATTNNNNNNNNNNNNNNAGTGTTCAG
TTTGTAATACGACTCACTATAGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTACATGTCAGATG
GAAACCGATTTGAGACGTACGTCTCAAATGCGGCCTGACAACTCAGACAGTTGCCAATTGCCGGCGCAGC
GTCTCCAACACCGGCGCCGAGGCAGGACGCACGCCACGCCAGAGGAAGAATGCCTCGGCGGCCTGCTCCA
CCAGCATGCCCAGGCCATCCAGGGTACGCGCCGCACCGCGTTCGTGCGGCCCAGCGGTTGAAGGCGGTCG
GTTCCTTGGCATACATCATGTCCACATCATCGGCAGGCCTGGCCACCATCACTTTACTGTTCTTGACAAC
TTCATTTCATCGGGTAGTCAGTACGTCGCGTCGGGGTAGGTCAGTTTCGTTACTGCCCGTATAACGACGT
TAAATGTAGGTCGTTCGCTCAATTGGAGATTTGATTAGGGGATCTCGAAGTATAAGCGTTCTTTCGAACA
GCGCCGTTTAATTACCGGTTTTTTCGCTGAAAATCTCGAGATTGCTGTGGGTAGGGCGGTGTCGAAACAG
AAGCACTAATAGGAAGATGTGTCACTTATCTGTTTGATTGAGTGAGGAGTTGAGGGTTGTTTAGGGGTGG
TTCACGCTCTATTTGGCCAACTCACTGTCTGTTGGGCTTGATTTTCTCGGTGATGAAGATGCGGATTGGA
ATAAAGCATATGGACAGTGCGTGTACGTTTCAAACTTCCAGTGGATAATATATCAGTGATTTGGATGTTA
CTTTTAGGTTCAAATAGAGTAAGAGTAAATTGTATGATCCTTTCTTCACTTCTTCACACTATTCTACTCG
CGCATCCTGCCGGGAGGATATAGGTATAGTCGCGTAGAGGAGAGCTTCGTAGTTACTGAGGGGGCCAGAA
TTTCGGTTG
Blast against PA14
Processed Seqquence ID: 8564
5' Trim Position: 73 3' Trim Position: 377
Processed Sequence:
(Transposon Sequence in Red)
GTAATACGACTCACTATAGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTACATGTCAGATGGAA
ACCGATTTGAGACGTACGTCTCAAATGCGGCCTGACAACTCAGACAGTTGCCAATTGCCGGCGCAGCGTC
TCCAACACCGGCGCCGAGGCAGGACGCACGCCACGCCAGAGGAAGAATGCCTCGGCGGCCTGCTCCACCA
GCATGCCCAGGCCATCCAGGGTACGCGCCGCACCGCGTTCGTGCGGCCCAGCGGTTGAAGGCGGTCGGTT
CCTTGGCATACATCATGTCCACAT
Blast against PA14
BLAST of Processed Sequence against PA14 And PAO1 Genome Sequence
38461 38461 38462 38462 38463 38463 38464 38464 38465 38465
PA14 BLAST Hit ID: 38461       Show Transposon Map
Identities: 244/245 (99.59%) BLAST Bit Score: 470.0 Percent of Processed Sequence That Aligns: 80.26%
Query Start: 55 Query End: 299 Subject Start: 27611 Subject End: 27368 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 27611 PA14_00270* +
Raw Sequence Start: 27738 PA14_00300 -
Extrapolated Insert Location:
Default Offset Location: 27675 PA14_00300 -
PA14 BLAST Hit ID: 38462       Show Transposon Map
Identities: 22/22 (100.00%) BLAST Bit Score: 44.1 Percent of Processed Sequence That Aligns: 6.91%
Query Start: 75 Query End: 96 Subject Start: 27570 Subject End: 27591 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 27570 PA14_00270* -
Raw Sequence Start: 27423 PA14_00270*,PA14_00290 -,+
Extrapolated Insert Location:
Default Offset Location: 27486 PA14_00270*,PA14_00290 -,+
PAO1 BLAST Hit ID: 38463       Show Transposon Map
Identities: 236/245 (96.32%) BLAST Bit Score: 406.0 Percent of Processed Sequence That Aligns: 80.26%
Query Start: 55 Query End: 299 Subject Start: 27590 Subject End: 27347 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 27590
Raw Sequence Start: 27717 PA0026 -
Extrapolated Insert Location:
Default Offset Location: 27654 PA0026 -
PAO1 BLAST Hit ID: 38464       Show Transposon Map
Identities: 22/22 (100.00%) BLAST Bit Score: 44.1 Percent of Processed Sequence That Aligns: 6.91%
Query Start: 75 Query End: 96 Subject Start: 27549 Subject End: 27570 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 27549
Raw Sequence Start: 27402 PA0025 +
Extrapolated Insert Location:
Default Offset Location: 27465 PA0025 +
PAO1 BLAST Hit ID: 38465       Show Transposon Map
Identities: 26/28 (92.85%) BLAST Bit Score: 40.1 Percent of Processed Sequence That Aligns: 8.88%
Query Start: 194 Query End: 221 Subject Start: 2509831 Subject End: 2509858 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 2509831 PA2281 -
Raw Sequence Start: 2509565 PA2281 -
Extrapolated Insert Location:
Default Offset Location: 2509628 PA2281 -
H PA14 Blast Hit H PAO1 Blast Hit