Mutant Report for Mutant ID: 28703

Strain: PA14 Genetic Background: Wild Type Transposon: MrT7 Library: lib_09_03
Raw Sequence ID: 12479
Chromat Path: H:\Pa14\MrT7\299v1\299v1_H11_H11_094.ab1 Last Transposon Base: 60 Transposon Sequence
Match Quality: 0
Raw Sequence:
(Transposon Sequence in Red)
TGTCAGTTGATCGACTCACTATAGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTACGTCCCCGC
CCAGAGCAAGTGGCCGATCATCGCCAGCATCGGCCTGCTGGTGACGGTGTTCGGCCTGGGTACCTGGTTC
AACGACCTCACCGCCGGCCACAAGGAATCCCATGGCCCGTGGATCTTCTTCGTCGGCGGGCTGATCATCG
CCTACATGCTGTTCGGCTGGTTCGGCAACGTCATCCGCGAGAGCCGCGCCGGACTCTACAGTGCGCAGAT
GGACCGCTCGTTCCGCTGGGGCATGAGCTGGTTCATCTTCTCCGAGGTGATGTTCTTCGCCGCCTTCTTC
GGCGCGCTGTTCTACGTCCGCCACTTCGCCGGTCCCTGGCTCGGCGGCGAGGGTGCCAAGGGCGTGGCGC
ACATGCTCTGGCCGAACTTCCAGTACAGCTGGCCGCTGCTGCAGACCCCGGACCCGAAGCTGTTCCCGCC
GCCGAGCGCGGTGATCGAGCCGTGGAAGCTGCCGCTGATCAACACCATCCTGCTGGTCACCTCCAGCTTC
ACCGTGACCTTCGCCCACCACGCCCTGAAGAAAAACAAGCGCGGCCCGCTCAAGGCCTGGCTGGCGTTGA
CCGTGCTGCTGGGGATCGCCTTCCTGATCCTGCAAGCCGAGGAGTACGTGCACGCCTACAACGAGCTGGG
GCTGACCCTCGGCGCCGGGTTCTACGGCTCGACCCTCTTCATGCTCACCGGCTTCCACGGCGCCCACGTA
ACCCTCGGCGGGCTGATCCTCACAATTATGGTGATCCGCATCCGGGGGGGCCCTTCAATGCCGAACCCAA
CTTAGCTTT
Blast against PA14
Processed Seqquence ID: 8284
5' Trim Position: 9 3' Trim Position: 586
Processed Sequence:
(Transposon Sequence in Red)
ATCGACTCACTATAGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTACGTCCCCGCCCAGAGCAA
GTGGCCGATCATCGCCAGCATCGGCCTGCTGGTGACGGTGTTCGGCCTGGGTACCTGGTTCAACGACCTC
ACCGCCGGCCACAAGGAATCCCATGGCCCGTGGATCTTCTTCGTCGGCGGGCTGATCATCGCCTACATGC
TGTTCGGCTGGTTCGGCAACGTCATCCGCGAGAGCCGCGCCGGACTCTACAGTGCGCAGATGGACCGCTC
GTTCCGCTGGGGCATGAGCTGGTTCATCTTCTCCGAGGTGATGTTCTTCGCCGCCTTCTTCGGCGCGCTG
TTCTACGTCCGCCACTTCGCCGGTCCCTGGCTCGGCGGCGAGGGTGCCAAGGGCGTGGCGCACATGCTCT
GGCCGAACTTCCAGTACAGCTGGCCGCTGCTGCAGACCCCGGACCCGAAGCTGTTCCCGCCGCCGAGCGC
GGTGATCGAGCCGTGGAAGCTGCCGCTGATCAACACCATCCTGCTGGTCACCTCCAGCTTCACCGTGACC
TTCGCCCACCACGCCCT
Blast against PA14
BLAST of Processed Sequence against PA14 And PAO1 Genome Sequence
37159 37159 37160 37160 37161 37161 37162 37162
PA14 BLAST Hit ID: 37159       Show Transposon Map
Identities: 528/528 (100.00%) BLAST Bit Score: 999.9 Percent of Processed Sequence That Aligns: 91.33%
Query Start: 50 Query End: 577 Subject Start: 128615 Subject End: 129142 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 128615 PA14_01320 +
Raw Sequence Start: 128557 PA14_01310 +
Extrapolated Insert Location: 128617 PA14_01320 +
Default Offset Location: 128620 PA14_01320 +
PA14 BLAST Hit ID: 37160       Show Transposon Map
Identities: 20/20 (100.00%) BLAST Bit Score: 40.1 Percent of Processed Sequence That Aligns: 3.29%
Query Start: 535 Query End: 554 Subject Start: 1797855 Subject End: 1797836 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 1797855 PA14_20870 +
Raw Sequence Start: 1798398 PA14_20870 +
Extrapolated Insert Location: 1798338 PA14_20870 +
Default Offset Location: 1798335 PA14_20870 +
PAO1 BLAST Hit ID: 37161       Show Transposon Map
Identities: 526/528 (99.62%) BLAST Bit Score: 999.9 Percent of Processed Sequence That Aligns: 91.33%
Query Start: 50 Query End: 577 Subject Start: 130700 Subject End: 131227 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 130700 PA0108 +
Raw Sequence Start: 130642 PA0107 +
Extrapolated Insert Location: 130702 PA0108 +
Default Offset Location: 130705 PA0108 +
PAO1 BLAST Hit ID: 37162       Show Transposon Map
Identities: 20/20 (100.00%) BLAST Bit Score: 40.1 Percent of Processed Sequence That Aligns: 3.29%
Query Start: 535 Query End: 554 Subject Start: 3749376 Subject End: 3749395 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 3749376 PA3339 +
Raw Sequence Start: 3748833 PA3339 +
Extrapolated Insert Location: 3748893 PA3339 +
Default Offset Location: 3748896 PA3339 +
H PA14 Blast Hit H PAO1 Blast Hit