Mutant Report for Mutant ID: 28019

Strain: PA14 Genetic Background: Wild Type Transposon: MrT7 Library: lib_09_03
Raw Sequence ID: 11795
Chromat Path: H:\Pa14\MrT7\292v1\292v1_G11_G11_088.ab1 Last Transposon Base: 64 Transposon Sequence
Match Quality: 0
Raw Sequence:
(Transposon Sequence in Red)
TGTTCAGTTTGTATACGACTCACTATAGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTAGCTGC
TGGCGTAATGGCCGAACGAGCCGGACACCGGCTCGTGCACCGCCATCTCGCCGAGCGCGCGCATCACCAT
GTACACCGCCGCGCCGGCGACCAGGTAGGCCAGCAGCACCGCCGGCCCGGCCATCTGGATGGCCGATGCG
GAACCGTAGAACAGGCCGGTGCCGATCGCCGACCCCAGTGCCATGAAACGAATATGACGGGCGTTCAGCC
CGCGCCGAAGCCCCGTGTCGTGCGTCATCCCTCGGCTCTCCTGTTGTTGTTCTTGCTGGAGCGCCCCGGC
CGAGCGGCCGGGGGCGGGTATCAAAGGCTCGGCAACAGCCGGGCCGGCAGCAGCGCGTTCAGGCAACCGC
TGGCGAGCAACTGGCTGGCGGCCTCGATGTCAGGGGCGAAGAAGCGATCCTCCTGGTAGTACGGCACCTT
GTCGCGCAGCAGGCGGCGAGCCTGCTCCAGCTTCGGCGAACTCTTCAGGCCCTCACGGAAGTCCAGGCCC
TGGCAGGCGCCCAGCCATTCCACGGCGAGAATCCCGCGGACGTTCTCGGCCATCGCCCAGAGCCGTTTGC
CGGCGTTCGGCGCCATCGACACGTGGTCTTCCTGGTTGGCCGAGGTCGGCAGGCTGTCGACGCTGGCCGG
ATGGGCCAGGGCCTTGTTGTCGCTGGCCAGCGCGGCGGCGGTGACCTGGGCGATCATGAAGCCGGAGTTG
ACCCCGCCGTTGGCCACCANGAACGGCGGCAACTGCGACATGTGCATGTNCTTCATCAGCGAGATGCGCC
GTTCCGACAGCGAACCGATCTCGGGCAAACGCCAAGGCAAGGTTT
Blast against PA14
Processed Seqquence ID: 7723
5' Trim Position: 4 3' Trim Position: 736
Processed Sequence:
(Transposon Sequence in Red)
CAGTTTGTATACGACTCACTATAGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTAGCTGCTGGC
GTAATGGCCGAACGAGCCGGACACCGGCTCGTGCACCGCCATCTCGCCGAGCGCGCGCATCACCATGTAC
ACCGCCGCGCCGGCGACCAGGTAGGCCAGCAGCACCGCCGGCCCGGCCATCTGGATGGCCGATGCGGAAC
CGTAGAACAGGCCGGTGCCGATCGCCGACCCCAGTGCCATGAAACGAATATGACGGGCGTTCAGCCCGCG
CCGAAGCCCCGTGTCGTGCGTCATCCCTCGGCTCTCCTGTTGTTGTTCTTGCTGGAGCGCCCCGGCCGAG
CGGCCGGGGGCGGGTATCAAAGGCTCGGCAACAGCCGGGCCGGCAGCAGCGCGTTCAGGCAACCGCTGGC
GAGCAACTGGCTGGCGGCCTCGATGTCAGGGGCGAAGAAGCGATCCTCCTGGTAGTACGGCACCTTGTCG
CGCAGCAGGCGGCGAGCCTGCTCCAGCTTCGGCGAACTCTTCAGGCCCTCACGGAAGTCCAGGCCCTGGC
AGGCGCCCAGCCATTCCACGGCGAGAATCCCGCGGACGTTCTCGGCCATCGCCCAGAGCCGTTTGCCGGC
GTTCGGCGCCATCGACACGTGGTCTTCCTGGTTGGCCGAGGTCGGCAGGCTGTCGACGCTGGCCGGATGG
GCCAGGGCCTTGTTGTCGCTGGCCAGCGCGGC
Blast against PA14
BLAST of Processed Sequence against PA14 And PAO1 Genome Sequence
34644 34644 34645 34645 34646 34646 34647 34647 34648 34648 34649 34649 34650 34650 34651 34651
PA14 BLAST Hit ID: 34644       Show Transposon Map
Identities: 673/673 (100.00%) BLAST Bit Score: 999.9 Percent of Processed Sequence That Aligns: 91.80%
Query Start: 60 Query End: 732 Subject Start: 6011849 Subject End: 6012521 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 6011849 PA14_67310,PA14_67290* -,+
Raw Sequence Start: 6011786 PA14_67310,PA14_67290* -,+
Extrapolated Insert Location: 6011850 PA14_67310,PA14_67290* -,+
Default Offset Location: 6011849 PA14_67310,PA14_67290* -,+
PA14 BLAST Hit ID: 34645       Show Transposon Map
Identities: 55/64 (85.93%) BLAST Bit Score: 56.0 Percent of Processed Sequence That Aligns: 8.61%
Query Start: 67 Query End: 130 Subject Start: 4793034 Subject End: 4793097 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 4793034 PA14_54040 -
Raw Sequence Start: 4792964 PA14_54040 -
Extrapolated Insert Location: 4793028 PA14_54040 -
Default Offset Location: 4793027 PA14_54040 -
PA14 BLAST Hit ID: 34646       Show Transposon Map
Identities: 29/32 (90.62%) BLAST Bit Score: 40.1 Percent of Processed Sequence That Aligns: 4.23%
Query Start: 146 Query End: 177 Subject Start: 6442354 Subject End: 6442385 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 6442354 PA14_72320,PA14_72310* -,-
Raw Sequence Start: 6442205 PA14_72320,PA14_72310* -,-
Extrapolated Insert Location: 6442269 PA14_72320,PA14_72310* -,-
Default Offset Location: 6442268 PA14_72320,PA14_72310* -,-
PA14 BLAST Hit ID: 34647       Show Transposon Map
Identities: 23/24 (95.83%) BLAST Bit Score: 40.1 Percent of Processed Sequence That Aligns: 3.14%
Query Start: 177 Query End: 200 Subject Start: 4793144 Subject End: 4793167 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 4793144 PA14_54040 -
Raw Sequence Start: 4792964 PA14_54040 -
Extrapolated Insert Location: 4793028 PA14_54040 -
Default Offset Location: 4793027 PA14_54040 -
PA14 BLAST Hit ID: 34648       Show Transposon Map
Identities: 20/20 (100.00%) BLAST Bit Score: 40.1 Percent of Processed Sequence That Aligns: 2.60%
Query Start: 115 Query End: 134 Subject Start: 3847819 Subject End: 3847800 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 3847819 PA14_43190 -
Raw Sequence Start: 3847937 PA14_43190 -
Extrapolated Insert Location: 3847873 PA14_43190 -
Default Offset Location: 3847874 PA14_43190 -
PAO1 BLAST Hit ID: 34649       Show Transposon Map
Identities: 664/673 (98.66%) BLAST Bit Score: 999.9 Percent of Processed Sequence That Aligns: 91.80%
Query Start: 60 Query End: 732 Subject Start: 5739590 Subject End: 5740262 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 5739590 PA5097 -
Raw Sequence Start: 5739527 PA5097 -
Extrapolated Insert Location: 5739591 PA5097 -
Default Offset Location: 5739590 PA5097 -
PAO1 BLAST Hit ID: 34650       Show Transposon Map
Identities: 55/64 (85.93%) BLAST Bit Score: 56.0 Percent of Processed Sequence That Aligns: 8.61%
Query Start: 67 Query End: 130 Subject Start: 864353 Subject End: 864290 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 864353 PA0789 -
Raw Sequence Start: 864423 PA0789 -
Extrapolated Insert Location: 864359 PA0789 -
Default Offset Location: 864360 PA0789 -
PAO1 BLAST Hit ID: 34651       Show Transposon Map
Identities: 23/24 (95.83%) BLAST Bit Score: 40.1 Percent of Processed Sequence That Aligns: 3.14%
Query Start: 177 Query End: 200 Subject Start: 864243 Subject End: 864220 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 864243 PA0789 -
Raw Sequence Start: 864423 PA0789 -
Extrapolated Insert Location: 864359 PA0789 -
Default Offset Location: 864360 PA0789 -
H PA14 Blast Hit H PAO1 Blast Hit