Mutant Report for Mutant ID: 27870

Strain: PA14 Genetic Background: Wild Type Transposon: MrT7 Library: lib_09_03
Raw Sequence ID: 11646
Chromat Path: H:\Pa14\MrT7\291v1\291v1_C06_C6_050.ab1 Last Transposon Base: 96 Transposon Sequence
Match Quality: 1
Raw Sequence:
(Transposon Sequence in Red)
GGATAGTTGATGTTATCTTTATCTCTCACCCTCGTATAATTGTCGTTTGAACGATCCTATAGGGGTTTCC
CACGGGGACTTATCAGCCAACCTGTTACATCGCCGCCTTGAGTCTCGGCCATAACCGCACCTTTGTTCGT
TTTATGGATGCTGTGCGAACAGCCTAGAGAACCCGGCGCAGGACGCAAATCGGCCGGCAAGAGAGTTTTC
TATCAGGGGAAAGGAAAGCTCTTTGTAGGAATCGCCCTACAAAAAAGATGCACCCCGGAATGGGCCAGAC
CGCTCTGGGAAGGGGCTTTCGAGAAGGGCAAAGGTTTGCGCGCCAGCGCTCTCCGGCTGGCGCGCAACGG
CGTCCTTCGCGCTTGGCCCAGTTCTGGAAACGCTGCTCCAGGGCCTCGCCGTGCTCCGCCCAGAAGGCCA
CTGTTATACCCACCGTGTTCATCTTCTGCAGGTCTGGCCAGCCTACCCACTATTATTTTGTAACACTATA
ACACTAACATACCTTATACGTATTCATATTACCATCATCAGGAAAGACGACTTCTCATCCTTGTTCCCTA
TGTTTCTCTCCTTTTTCTACTCATTTCTCTTTACTTTCATTTTATCGTACACAACTTTAACTCCCTGTAC
TAATCGTAACCAACTTATATTGCATATAATTTATACGTTGACTATGTAACAATAATAATATATTAATTAT
CTATCTCTGACCTTCTCAAGCCTCCATTACTATACTATTGTATGTTACTCTCTCTCTTACTCTCTTTGCT
CCTTCGTCTTCTATAGACAATCCTATAATCTACACACTTTTGTTCCCGATGTACGTCGCCGCACGCCTCA
CAACACACCAAAAGAATCATGCTAATACTATTTACTTCACTCGCCATACCTACCTTATTCCATATTCATT
CATCACTTCTGTCCCTCTCACCCACCGCACAACCCATCCGTCTCGCTTCTCAACAACGCACATCCAACTG
CTCCTCATAATTACTTTACTGTGTTTTGTTTTTGGCTCCATTATATTGTTTCATACGCGCTCCTGCTCCC
AGTATTCCAGCCCTCCATTCACTTGCTACATCCGCATACTGCCTTATATTGCGTAGCTGTCTATAATCTG
AATTCAGCCTATCTCTCTCTCCCATTAAATGN
Blast against PA14
Processed Seqquence ID: 7593
5' Trim Position: 69 3' Trim Position: 392
Processed Sequence:
(Transposon Sequence in Red)
CCACGGGGACTTATCAGCCAACCTGTTACATCGCCGCCTTGAGTCTCGGCCATAACCGCACCTTTGTTCG
TTTTATGGATGCTGTGCGAACAGCCTAGAGAACCCGGCGCAGGACGCAAATCGGCCGGCAAGAGAGTTTT
CTATCAGGGGAAAGGAAAGCTCTTTGTAGGAATCGCCCTACAAAAAAGATGCACCCCGGAATGGGCCAGA
CCGCTCTGGGAAGGGGCTTTCGAGAAGGGCAAAGGTTTGCGCGCCAGCGCTCTCCGGCTGGCGCGCAACG
GCGTCCTTCGCGCTTGGCCCAGTTCTGGAAACGCTGCTCCAGG
Blast against PA14
BLAST of Processed Sequence against PA14 And PAO1 Genome Sequence
34223 34223 34224 34224
PA14 BLAST Hit ID: 34223       Show Transposon Map
Identities: 295/297 (99.32%) BLAST Bit Score: 573.0 Percent of Processed Sequence That Aligns: 91.64%
Query Start: 27 Query End: 323 Subject Start: 677630 Subject End: 677334 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 677630 PA14_07860 -
Raw Sequence Start: 677725 PA14_07860 -
Extrapolated Insert Location: 677629 PA14_07860 -
Default Offset Location: 677662 PA14_07860 -
PAO1 BLAST Hit ID: 34224       Show Transposon Map
Identities: 288/296 (97.29%) BLAST Bit Score: 523.0 Percent of Processed Sequence That Aligns: 91.33%
Query Start: 28 Query End: 323 Subject Start: 664808 Subject End: 664513 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 664808 PA0603 -
Raw Sequence Start: 664904 PA0603 -
Extrapolated Insert Location: 664808 PA0603 -
Default Offset Location: 664841 PA0603 -
H PA14 Blast Hit H PAO1 Blast Hit