Mutant Report for Mutant ID: 27774

Strain: PA14 Genetic Background: Wild Type Transposon: MrT7 Library: lib_09_03
Raw Sequence ID: 11550
Chromat Path: H:\Pa14\MrT7\290v1\290v1_C06_C6_040.ab1 Last Transposon Base: Transposon Sequence
Match Quality:
Raw Sequence:
(Transposon Sequence in Red)
NNNNNNNNNNNNNNNNNNNNNNNNNNCCCCNNTTTTNNNNNNNNNTTTTNNNTTTTTTGTCAGTTTGTAT
ACGACTCGTATGCCATGTCTGCCGCCCGGGGAGTTATTCACCGAGCTCGAAAATAGGGCGAAACACCACG
TATACTGGTTACCGGCATCTTCTGCGGGCCTGACCACCTTGATGTTCGAGGGCTTCTCGTGGCCGATCGG
TACCAGCCAGTTCAGCGACCAACTGCCGCGCGCCTGGTGCGTGTAGCTGTCGCGCACCGGCTTGTTCGGC
TCGACGCCGCCTTCGAGGCGGATGGTTCTGCCTTCGTTGGTGATGCTGTTGGTGTTGTCTATGGCCATTT
TGCATGCCTCTTTTTCGTCCTTCTTGATCTTGGTGCCGTGCTGCCCGCCCTGGTCTTTGGTTTTTTTGAT
GTTTGTTTTCTCGTTGTTGCGTTTGGTCTGTTCTCTTGTTTTTCTTGTCGTGTCCGCTTGCCTTGGCGCA
TTTTTTTCACAAACCCGTAGTCTTCCTTCCGCTGCGGAGTTGTTCCAATCGCCGGCTAGCCATTTTTATC
TTTGGTCCCAGCCTGTTCCACTTCCGTATTTTTTTCATCCTTCCTGGTTTCCTTTTTTCTTGTTTCTAGT
TGCTTTCTTTCCCCTTTTTTTTTCTTTCTTTCCCCTTCTCTGTGTCTTCCCTTGCCTATTAATGTTCCGT
TTTTTGTTTTGGCTGTTGTCTATTTTTAATTTCCTTTTCTTGTTTTTTGTCATCTCCTCCCTTTTCCTGT
TTTTTTTCTTTGTCCTGGGTGCTGGACGTTCCCCCCTTTCGTCCTTCTCCCTCCCCCAGTGTGTGTTGTT
TATTTGTGGATACTCCGGCCCTTTCTCCTACCTCACTGAGTCTAGCTTGCTGGGTTTTTGCTATTCTTTT
TTTTTTCCACTTTCCATTTTGTTTTTTCCCTCGCTT
Blast against PA14
Processed Seqquence ID: 7502
5' Trim Position: 170 3' Trim Position: 302
Processed Sequence:
(Transposon Sequence in Red)
TGACCACCTTGATGTTCGAGGGCTTCTCGTGGCCGATCGGTACCAGCCAGTTCAGCGACCAACTGCCGCG
CGCCTGGTGCGTGTAGCTGTCGCGCACCGGCTTGTTCGGCTCGACGCCGCCTTCGAGGCGGA
Blast against PA14
BLAST of Processed Sequence against PA14 And PAO1 Genome Sequence
33830 33830 33831 33831
PA14 BLAST Hit ID: 33830       Show Transposon Map
Identities: 126/128 (98.43%) BLAST Bit Score: 238.0 Percent of Processed Sequence That Aligns: 96.21%
Query Start: 5 Query End: 132 Subject Start: 4407860 Subject End: 4407733 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 4407860 PA14_49560,PA14_49550* -,+
Raw Sequence Start: 4408034 PA14_49560,PA14_49550* -,+
Extrapolated Insert Location:
Default Offset Location: 4407971 PA14_49560,PA14_49550* -,+
PAO1 BLAST Hit ID: 33831       Show Transposon Map
Identities: 123/128 (96.09%) BLAST Bit Score: 214.0 Percent of Processed Sequence That Aligns: 96.21%
Query Start: 5 Query End: 132 Subject Start: 1242081 Subject End: 1242208 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 1242081 PA1148 -
Raw Sequence Start: 1241907 PA1148 -
Extrapolated Insert Location:
Default Offset Location: 1241970 PA1148 -
H PA14 Blast Hit H PAO1 Blast Hit