Mutant Report for Mutant ID: 27684

Strain: PA14 Genetic Background: Wild Type Transposon: MrT7 Library: lib_09_03
Raw Sequence ID: 11460
Chromat Path: H:\Pa14\MrT7\289v1\289v1_C12_C12_098.ab1 Last Transposon Base: 60 Transposon Sequence
Match Quality: 0
Raw Sequence:
(Transposon Sequence in Red)
TGTCGTTTGTATCGACTCCTATAGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTAGCTCTTCTG
CACGCCACGGAAGCTGACCAGTACATCGCCGCCTTGAGTCTCGGCCATAACCGCACCTTTGTTCGTTTTA
TGGATGCTGTGCGAACAGCCTAGAGAACCCGGCGCAGGACGCAAATCGGCCGGCAAGAGAGTTTTCTATC
AGGGGAAAGGAAAGCTCTTTGTAGGAATCGCCCTACAAAAAAGATGCACCCCGGAATGGGCCAGACCGCT
CTGGGAAGGGGCTTTCGAGAAGGGCAAAGGTTTGCGCGCCAGCGCTCTCCGGCTGGCGCGCAACGGCGTC
CTCAGCGCTTGGCCCAGTTCTGGAAACGCTGCTCCAGGGCCTCGCCGTGCTCCGCCCAGAAGGCCACGTT
CATACCCCCCCCCCCCATCACTGAAGGGGCCCTGGCCAAANNNGNNNNGNNTGNNNNANNNNNNNNNNNN
NNNNNNNNNANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGNNGNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGNNNNNNNNNNNNNNNNNNNNNNNNNNNG
NNNNNNNANNNNNNNNNNGNNNANNNNNNNNNNNTNNNNNNNNNNNNNNNGGGGGGAGGNGGGGGGGGGG
GGNNGGGGGGTTGGGGGGGNNGGGGGGGGGGGNGGNGGGGGGNNGGNNGGGGGGGGGGGNNGNGNNGGGG
GGGGGGNNGGGGNNGGGGGGNNGGNNTTTTNNNGNNNGGGGGTTTGGNGGGGTTNGGNGNGNNGGGTGNG
TGGGGGGTGTTGGTGTGNGGNGTTGATNGGTGGTTGGGTGTGTTTATGGTTTGTGGNNTTTTTGTTGTGT
TTGTTTTTTGTNGTTTTGTGTTTGT
Blast against PA14
Processed Seqquence ID: 7415
5' Trim Position: 8 3' Trim Position: 438
Processed Sequence:
(Transposon Sequence in Red)
GTATCGACTCCTATAGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTAGCTCTTCTGCACGCCAC
GGAAGCTGACCAGTACATCGCCGCCTTGAGTCTCGGCCATAACCGCACCTTTGTTCGTTTTATGGATGCT
GTGCGAACAGCCTAGAGAACCCGGCGCAGGACGCAAATCGGCCGGCAAGAGAGTTTTCTATCAGGGGAAA
GGAAAGCTCTTTGTAGGAATCGCCCTACAAAAAAGATGCACCCCGGAATGGGCCAGACCGCTCTGGGAAG
GGGCTTTCGAGAAGGGCAAAGGTTTGCGCGCCAGCGCTCTCCGGCTGGCGCGCAACGGCGTCCTCAGCGC
TTGGCCCAGTTCTGGAAACGCTGCTCCAGGGCCTCGCCGTGCTCCGCCCAGAAGGCCACGTTCATACCCC
CCCCCCCCAT
Blast against PA14
BLAST of Processed Sequence against PA14 And PAO1 Genome Sequence
33349 33349 33350 33350
PA14 BLAST Hit ID: 33349       Show Transposon Map
Identities: 365/365 (100.00%) BLAST Bit Score: 724.0 Percent of Processed Sequence That Aligns: 84.65%
Query Start: 52 Query End: 416 Subject Start: 677662 Subject End: 677298 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 677662 PA14_07860 -
Raw Sequence Start: 677721 PA14_07860 -
Extrapolated Insert Location: 677661 PA14_07860 -
Default Offset Location: 677658 PA14_07860 -
PAO1 BLAST Hit ID: 33350       Show Transposon Map
Identities: 357/365 (97.80%) BLAST Bit Score: 660.0 Percent of Processed Sequence That Aligns: 84.65%
Query Start: 52 Query End: 416 Subject Start: 664841 Subject End: 664477 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 664841 PA0603 -
Raw Sequence Start: 664900 PA0603 -
Extrapolated Insert Location: 664840 PA0603 -
Default Offset Location: 664837 PA0603 -
H PA14 Blast Hit H PAO1 Blast Hit