Mutant Report for Mutant ID: 27373

Strain: PA14 Genetic Background: Wild Type Transposon: MrT7 Library: lib_09_03
Raw Sequence ID: 11149
Chromat Path: H:\Pa14\MrT7\286v1\286v1_B01_B1_011.ab1 Last Transposon Base: 60 Transposon Sequence
Match Quality: 1
Raw Sequence:
(Transposon Sequence in Red)
TGTCGTTGTATACGACTCCTATATGGGTCTAGAGACCGGAGACTTATCAGCCAACCTGTTACAGCCTGGA
CTTCTGCTACTTCGGCGAGAAGCGCAACGTCACCGCGACGGTGAACTACCAGTTCTGACCGTCCACCCGG
GCCCCGGCGCCAGCGCCGCGGTACCGGCCAAGCAGCCCGGCGCGCAACGTACGCGCCGGGCATTCGCCGG
CGTCGCCGGCCGTACCCTGGTTACCTGGAGCCCCCATACGCCCCGTCCTCATCATCTGCAGGCCTGGCCA
TTTATATATATAAGAGGAGAATACTTACCACCTATAACTCTAAGAAATTATAGTGATATGACAAATAAAT
TTAAGTAAAGAATTTAAAAAAAAATTTATATTATTTTATATATATTATTTGATTTTTTTTTCTATTTTGT
ATTATTTTTAAGTTATATTAAACAATGATTTTTTTCATTTGTTTTTTTATAATTTATACATAACTTTGAT
AATCCATTTATATTTTTTCATATTCCAGTTACATTCATTTTTTACTAAAGAAATACATATCTATTTATTT
TGTTCAGGAATATTTATACGTGTTAACGATTTATTTCTTTTTTTATTATATTTTTTTTTTTTGCCTTTCT
TGATTTAAATAACAAATAACAGAATATATTTTGATATTTATTTTATTAAAATATTTTTTTTATGATAGAT
ACCATGATACGATTTACACAGACAAGATATGTAGTTGTGATTAATGATTGAGTGAAGATACGTCAGGATA
CGCCTCAATCGACAGAGTTAGGTTAAAACCGTGTCTCAACATGATATTACTGCGTGTGACTATAATATGT
TGGTTTGATGTATAGGGGGTGTTTTGGTCCGGGAGTGTAATATACGATTATTAGAGTATGTCACTGCAGT
GTGGAAGAGATAACCGCACTAATTGTATGTAATGATACCACATTTATNAGGTGTGAAGTAAAATGATTAA
CATN
Blast against PA14
Processed Seqquence ID: 7120
5' Trim Position: 22 3' Trim Position: 277
Processed Sequence:
(Transposon Sequence in Red)
ATGGGTCTAGAGACCGGAGACTTATCAGCCAACCTGTTACAGCCTGGACTTCTGCTACTTCGGCGAGAAG
CGCAACGTCACCGCGACGGTGAACTACCAGTTCTGACCGTCCACCCGGGCCCCGGCGCCAGCGCCGCGGT
ACCGGCCAAGCAGCCCGGCGCGCAACGTACGCGCCGGGCATTCGCCGGCGTCGCCGGCCGTACCCTGGTT
ACCTGGAGCCCCCATACGCCCCGTCCTCATCATCTGCAGGCCTGG
Blast against PA14
BLAST of Processed Sequence against PA14 And PAO1 Genome Sequence
31933 31933 31934 31934
PA14 BLAST Hit ID: 31933       Show Transposon Map
Identities: 203/205 (99.02%) BLAST Bit Score: 391.0 Percent of Processed Sequence That Aligns: 80.00%
Query Start: 33 Query End: 237 Subject Start: 2844535 Subject End: 2844739 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 2844535 PA14_32740,PA14_32730* +,-
Raw Sequence Start: 2844481 PA14_32740,PA14_32730* +,-
Extrapolated Insert Location: 2844541 PA14_32740,PA14_32730* +,-
Default Offset Location: 2844544 PA14_32740,PA14_32730* +,-
PAO1 BLAST Hit ID: 31934       Show Transposon Map
Identities: 202/205 (98.53%) BLAST Bit Score: 383.0 Percent of Processed Sequence That Aligns: 80.00%
Query Start: 33 Query End: 237 Subject Start: 2782836 Subject End: 2782632 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 2782836 PA2466 +
Raw Sequence Start: 2782890 PA2466 +
Extrapolated Insert Location: 2782830 PA2466 +
Default Offset Location: 2782827 PA2466 +
H PA14 Blast Hit H PAO1 Blast Hit