Mutant Report for Mutant ID: 26660

Strain: PA14 Genetic Background: Wild Type Transposon: MrT7 Library: lib_09_03
Raw Sequence ID: 10436
Chromat Path: H:\Pa14\MrT7\278v1\278v1_F08_F8_073.ab1 Last Transposon Base: 61 Transposon Sequence
Match Quality: 0
Raw Sequence:
(Transposon Sequence in Red)
TGTCGTTTGTATACGACTCCTATAGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTAAGTGTGGT
GATTGGACATGAACTCTCTCCCCGGACGATGCCTGGGTCTTCGCACCCGACGGGCGCCTCTGTTCAATGG
ACACTAGCCGAGCCGGAAAAGTGCAGCAAATCGCCAGCGCTCAGCCTGCCAACTGCTCCCGCAACCAATA
CGCCAGGCGCCCGGCACGCGGATCGTGCAGGCGCGCCGGTACCCACAGGGCCAGGCGCGCATCGGTCTCG
ATGAAGCCCCAGGGCGCCGCCAGGCGGCCCGCGGCGAGATCGTCGCGGACCAGCGCCTCCGGGGCGATGG
CCACGCCGAGGCCCGCCACCGCCGCTTCCAGCAGGTAGTAGAGATGCTCGAACCCCTGGCCATAGCGCAG
CGCCTCCGCCGCCAGCCCCTGGCTCGCGGCCCAGGCCGGCCAGGCCTGGGGCCGCGAGGCGGTATGCAGC
AGCGGCTCCTGCAACAGCCGCGCGGCGGGCGCCTGGGCCAGGCCGGTTTCCTGCGCCAGGCGCGGGCTGA
CCACCGGGCCCATGCGCTCGGGCGCCAGTTCGAAGACCTTGCTGTCCGCCGGCCAGGGCGGGCTCGGCCG
AACCAGACAATGGCGTCCCAGCCCGGGACGACCGCGGATCGAAACTCGCCTTTCCCTTGGTGGACCGTTT
GCAGGCCCCAGGTCGGGGAAGGGCACTGTTTGAACCCGGCCCAGCCCGCGGAATAAACCAACCCGCCCAC
AGGCTGCCGGGTACCCCCAGAACAAAAGGGGCCTCGTGGGTTTCCGGGCCATTTTGGCAAAAACGCACAC
AATCTCTCGAAACCATCCCCCAGG
Blast against PA14
Processed Seqquence ID: 6465
5' Trim Position: 12 3' Trim Position: 512
Processed Sequence:
(Transposon Sequence in Red)
ACGACTCCTATAGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTAAGTGTGGTGATTGGACATGA
ACTCTCTCCCCGGACGATGCCTGGGTCTTCGCACCCGACGGGCGCCTCTGTTCAATGGACACTAGCCGAG
CCGGAAAAGTGCAGCAAATCGCCAGCGCTCAGCCTGCCAACTGCTCCCGCAACCAATACGCCAGGCGCCC
GGCACGCGGATCGTGCAGGCGCGCCGGTACCCACAGGGCCAGGCGCGCATCGGTCTCGATGAAGCCCCAG
GGCGCCGCCAGGCGGCCCGCGGCGAGATCGTCGCGGACCAGCGCCTCCGGGGCGATGGCCACGCCGAGGC
CCGCCACCGCCGCTTCCAGCAGGTAGTAGAGATGCTCGAACCCCTGGCCATAGCGCAGCGCCTCCGCCGC
CAGCCCCTGGCTCGCGGCCCAGGCCGGCCAGGCCTGGGGCCGCGAGGCGGTATGCAGCAGCGGCTCCTGC
AACAGCCGCG
Blast against PA14
BLAST of Processed Sequence against PA14 And PAO1 Genome Sequence
29214 29214 29215 29215 29216 29216 29217 29217 29218 29218 29219 29219 29220 29220 29221 29221
PA14 BLAST Hit ID: 29214       Show Transposon Map
Identities: 446/449 (99.33%) BLAST Bit Score: 866.0 Percent of Processed Sequence That Aligns: 89.60%
Query Start: 52 Query End: 500 Subject Start: 40227 Subject End: 39779 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 40227 PA14_00470 -
Raw Sequence Start: 40290 PA14_00470 -
Extrapolated Insert Location: 40229 PA14_00470 -
Default Offset Location: 40227 PA14_00470 -
PA14 BLAST Hit ID: 29215       Show Transposon Map
Identities: 22/22 (100.00%) BLAST Bit Score: 44.1 Percent of Processed Sequence That Aligns: 4.20%
Query Start: 426 Query End: 447 Subject Start: 4545324 Subject End: 4545303 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 4545324 PA14_51150,PA14_51140*,PA14_51130* +,-,+
Raw Sequence Start: 4545761 PA14_51150,PA14_51140*,PA14_51130* +,-,+
Extrapolated Insert Location: 4545700 PA14_51150,PA14_51140*,PA14_51130* +,-,+
Default Offset Location: 4545698 PA14_51150,PA14_51140*,PA14_51130* +,-,+
PA14 BLAST Hit ID: 29216       Show Transposon Map
Identities: 23/24 (95.83%) BLAST Bit Score: 40.1 Percent of Processed Sequence That Aligns: 4.60%
Query Start: 425 Query End: 448 Subject Start: 4113929 Subject End: 4113906 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 4113929 PA14_46250 -
Raw Sequence Start: 4114365 PA14_46250 -
Extrapolated Insert Location: 4114304 PA14_46250 -
Default Offset Location: 4114302 PA14_46250 -
PA14 BLAST Hit ID: 29217       Show Transposon Map
Identities: 20/20 (100.00%) BLAST Bit Score: 40.1 Percent of Processed Sequence That Aligns: 3.80%
Query Start: 199 Query End: 218 Subject Start: 1686889 Subject End: 1686870 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 1686889 PA14_19510 -
Raw Sequence Start: 1687099 PA14_19510 -
Extrapolated Insert Location: 1687038 PA14_19510 -
Default Offset Location: 1687036 PA14_19510 -
PAO1 BLAST Hit ID: 29218       Show Transposon Map
Identities: 441/449 (98.21%) BLAST Bit Score: 827.0 Percent of Processed Sequence That Aligns: 89.60%
Query Start: 52 Query End: 500 Subject Start: 40206 Subject End: 39758 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 40206 PA0038 -
Raw Sequence Start: 40269 PA0038 -
Extrapolated Insert Location: 40208 PA0038 -
Default Offset Location: 40206 PA0038 -
PAO1 BLAST Hit ID: 29219       Show Transposon Map
Identities: 22/22 (100.00%) BLAST Bit Score: 44.1 Percent of Processed Sequence That Aligns: 4.20%
Query Start: 426 Query End: 447 Subject Start: 1104607 Subject End: 1104628 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 1104607 PA1019 +
Raw Sequence Start: 1104170 PA1019 +
Extrapolated Insert Location: 1104231 PA1019 +
Default Offset Location: 1104233 PA1019 +
PAO1 BLAST Hit ID: 29220       Show Transposon Map
Identities: 20/20 (100.00%) BLAST Bit Score: 40.1 Percent of Processed Sequence That Aligns: 3.80%
Query Start: 199 Query End: 218 Subject Start: 3854160 Subject End: 3854179 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 3854160 PA3448 -
Raw Sequence Start: 3853950 PA3448 -
Extrapolated Insert Location: 3854011 PA3448 -
Default Offset Location: 3854013 PA3448 -
PAO1 BLAST Hit ID: 29221       Show Transposon Map
Identities: 23/24 (95.83%) BLAST Bit Score: 40.1 Percent of Processed Sequence That Aligns: 4.60%
Query Start: 425 Query End: 448 Subject Start: 1530288 Subject End: 1530311 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 1530288 PA1407 -
Raw Sequence Start: 1529852 PA1407 -
Extrapolated Insert Location: 1529913 PA1407 -
Default Offset Location: 1529915 PA1407 -
H PA14 Blast Hit H PAO1 Blast Hit