Mutant Report for Mutant ID: 26449

Strain: PA14 Genetic Background: Wild Type Transposon: MrT7 Library: lib_09_03
Raw Sequence ID: 10225
Chromat Path: H:\Pa14\MrT7\276v1\276v1_E01_E1_005.ab1 Last Transposon Base: 60 Transposon Sequence
Match Quality: 0
Raw Sequence:
(Transposon Sequence in Red)
ACGTTTGTATACGACTCACTATAGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTAGTCCTGGTG
CGCGGGCATCCAGCCGCCGAGGAAGGCGTCCACCTGGCCGTCGCGCAGGCCGCCATAGATGATCGGCACC
GACAGGGTATCGATCTTCACCTGGTAGCCGAGGCTTTCCAGGAGAAACGCGGCGGTGGCGTTGGTCACCG
CGATATCGCTCCAGCCTGGATCGGCCAGCCTGACGCGGGCACAGGCGGGGTCTTCGGCGTATAGCGAGGC
GCTGCCCAGGAACAGGGTGGCGGCCAGCAGGCAGGTGGGAAGCCGGTTCATGGAAGTGCCCTCGTGCTCA
GGGTTGCGGGAAGCGCGCGCGGCGCTCGAGATCGTCCAGGTCGATATGGTTGCGCATGTACTGCTGGCTG
GCGTCAAACCACGGCTGGTGGTCCCAACTGGGCAGCCGCCCTCGCGCCAGCGCGGCGGCCACCAGGCGTC
GGCGGCGCTGGCTGTCTAGTACGGCGCGGGTGATCGCGGGGATGTCCCAACGTCGCCGGGGCCTCGTCGA
AGAACGCCTCGAAACGTTCCCCGATGGGGCCGAACTTGGCGGCAAGGTTTCTCCGCGCTCCTTGCGGGTC
GTTGCCCCAGGTCTTAAAACAAGGCAGGGGTCCCTGCTCCGGAGTAAAATGAACTTGTAATTCCCCGCCG
GCGTGATAATCATTTGGCAGGGCCTTAGAAAAATATATATATAGTTGTTGTCAACGATTATGTTTCAGTG
TGAGTACAAGGGGGCGTGTTTGTGGTTGTGAGTGAGTGCGTGAATGTCTGTCTATTATGTATAGGATGAT
TAGTTAAATTCATTAAATACCATAACGTATTATTCGCACATACGCACATATGTCTGCGCGCTGTCATAGC
TACAGGGTGAGATCGN
Blast against PA14
Processed Seqquence ID: 6289
5' Trim Position: 6 3' Trim Position: 468
Processed Sequence:
(Transposon Sequence in Red)
GTATACGACTCACTATAGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTAGTCCTGGTGCGCGGG
CATCCAGCCGCCGAGGAAGGCGTCCACCTGGCCGTCGCGCAGGCCGCCATAGATGATCGGCACCGACAGG
GTATCGATCTTCACCTGGTAGCCGAGGCTTTCCAGGAGAAACGCGGCGGTGGCGTTGGTCACCGCGATAT
CGCTCCAGCCTGGATCGGCCAGCCTGACGCGGGCACAGGCGGGGTCTTCGGCGTATAGCGAGGCGCTGCC
CAGGAACAGGGTGGCGGCCAGCAGGCAGGTGGGAAGCCGGTTCATGGAAGTGCCCTCGTGCTCAGGGTTG
CGGGAAGCGCGCGCGGCGCTCGAGATCGTCCAGGTCGATATGGTTGCGCATGTACTGCTGGCTGGCGTCA
AACCACGGCTGGTGGTCCCAACTGGGCAGCCGCCCTCGCGCC
Blast against PA14
BLAST of Processed Sequence against PA14 And PAO1 Genome Sequence
28289 28289 28290 28290 28291 28291 28292 28292
PA14 BLAST Hit ID: 28289       Show Transposon Map
Identities: 406/409 (99.26%) BLAST Bit Score: 787.0 Percent of Processed Sequence That Aligns: 88.31%
Query Start: 54 Query End: 462 Subject Start: 32733 Subject End: 33141 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 32733 PA14_00350*,PA14_00360 +,-
Raw Sequence Start: 32674 PA14_00350*,PA14_00360 +,-
Extrapolated Insert Location: 32734 PA14_00350*,PA14_00360 +,-
Default Offset Location: 32737 PA14_00350*,PA14_00360 +,-
PA14 BLAST Hit ID: 28290       Show Transposon Map
Identities: 26/28 (92.85%) BLAST Bit Score: 40.1 Percent of Processed Sequence That Aligns: 5.84%
Query Start: 74 Query End: 101 Subject Start: 4236291 Subject End: 4236318 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 4236291 PA14_47560 -
Raw Sequence Start: 4236212 PA14_47560 -
Extrapolated Insert Location: 4236272 PA14_47560 -
Default Offset Location: 4236275 PA14_47560 -
PAO1 BLAST Hit ID: 28291       Show Transposon Map
Identities: 401/409 (98.04%) BLAST Bit Score: 747.0 Percent of Processed Sequence That Aligns: 88.31%
Query Start: 54 Query End: 462 Subject Start: 32712 Subject End: 33120 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 32712 PA0030 -
Raw Sequence Start: 32653 PA0030 -
Extrapolated Insert Location: 32713 PA0030 -
Default Offset Location: 32716 PA0030 -
PAO1 BLAST Hit ID: 28292       Show Transposon Map
Identities: 26/28 (92.85%) BLAST Bit Score: 40.1 Percent of Processed Sequence That Aligns: 5.84%
Query Start: 74 Query End: 101 Subject Start: 1398306 Subject End: 1398279 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 1398306 PA1286 -
Raw Sequence Start: 1398385 PA1286 -
Extrapolated Insert Location: 1398325 PA1286 -
Default Offset Location: 1398322 PA1286 -
H PA14 Blast Hit H PAO1 Blast Hit