Mutant Report for Mutant ID: 26176

Strain: PA14 Genetic Background: Wild Type Transposon: MrT7 Library: lib_09_03
Raw Sequence ID: 9952
Chromat Path: H:\Pa14\MrT7\273v1\273v1_F04_F4_041.ab1 Last Transposon Base: 61 Transposon Sequence
Match Quality: 0
Raw Sequence:
(Transposon Sequence in Red)
TGTCGTTTGTATACGACTCGTATAGGGTGCTAGAGACCGGGGACTTATCAGCCAACCTGTTAAAACCGGT
AAGCCTGACGCATCTCCTCGGTGGCGTAGGAGGAGTTCCTGAACACCAGGGCGTCCTTGACGATGTTCTT
GTGGGTCGGTTGCGACCAGGCGTTGGCCTGGCTGGCGATGGCGCAGATGCAGAGACCGGCGGCCAGGCGG
GCGAAGGTTTTCATCGGCAGCGCTCGAGAGTGAGTGAAGCCTGAAGTCTTAACCCGGTTTTGTGATTCCT
ACATGTCAGATGGAAACCGATTTGAGACGTACGTCTCAAATGCGGCCTGACAACTCAGACAGTTGCCAAT
TGCCGGCGCAGCGTCTCCAACACCGGCGCCGAGGCAGGACGCACGCCACGCCAGAGGAAGAATGCCTCGG
CGGCCTGCTCCACCAGCATGCCCAGGCCATCCAGGGTACGCGCCGCACCGCGTTCGGCGGCCCAGCGGTT
GAAGGCGGTCGGTTCCTTGGCATACATCATGTCGTAATCAACTGTAGGCCTGGCCATCATCATTTGCATG
CCTGGCCAGCTCTTCTTCCCTTGTTAACTGGCATAAGTGGCCGTTAACATCAGTCCTAATGGCCTTTCGC
CATCTTTTAAATCTCATCCTATCCCTGCCCCATTTCCGCTAATTGCTTCGCACTGGCCTCTGTTCTTCCC
CCGCCCGCTTTTTGCCTATTTTCCTATTCCCTTTGGTCCCTCCCCCATTAAGTGTTTAAATCCCCCTCGC
ACCGGACGTCCCGGGTTCTATGAATGTATTCCCCCTATGTCCCGTCTCTTGTCCCCCTTGTTTTCTCCTT
TTTGTTTCCCCTTTTACTTTCTTCCGTTTCTCTTTTTTTTCTTCCT
Blast against PA14
Processed Seqquence ID: 6075
5' Trim Position: 72 3' Trim Position: 522
Processed Sequence:
(Transposon Sequence in Red)
GCCTGACGCATCTCCTCGGTGGCGTAGGAGGAGTTCCTGAACACCAGGGCGTCCTTGACGATGTTCTTGT
GGGTCGGTTGCGACCAGGCGTTGGCCTGGCTGGCGATGGCGCAGATGCAGAGACCGGCGGCCAGGCGGGC
GAAGGTTTTCATCGGCAGCGCTCGAGAGTGAGTGAAGCCTGAAGTCTTAACCCGGTTTTGTGATTCCTAC
ATGTCAGATGGAAACCGATTTGAGACGTACGTCTCAAATGCGGCCTGACAACTCAGACAGTTGCCAATTG
CCGGCGCAGCGTCTCCAACACCGGCGCCGAGGCAGGACGCACGCCACGCCAGAGGAAGAATGCCTCGGCG
GCCTGCTCCACCAGCATGCCCAGGCCATCCAGGGTACGCGCCGCACCGCGTTCGGCGGCCCAGCGGTTGA
AGGCGGTCGGTTCCTTGGCATACATCATGT
Blast against PA14
BLAST of Processed Sequence against PA14 And PAO1 Genome Sequence
27210 27210 27211 27211 27212 27212 27213 27213 27214 27214
PA14 BLAST Hit ID: 27210       Show Transposon Map
Identities: 447/450 (99.33%) BLAST Bit Score: 868.0 Percent of Processed Sequence That Aligns: 99.78%
Query Start: 1 Query End: 450 Subject Start: 27818 Subject End: 27369 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 27818 PA14_00300 -
Raw Sequence Start: 27890 PA14_00300 -
Extrapolated Insert Location: 27829 PA14_00300 -
Default Offset Location: 27827 PA14_00300 -
PA14 BLAST Hit ID: 27211       Show Transposon Map
Identities: 22/22 (100.00%) BLAST Bit Score: 44.1 Percent of Processed Sequence That Aligns: 4.67%
Query Start: 228 Query End: 249 Subject Start: 27570 Subject End: 27591 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 27570 PA14_00270* -
Raw Sequence Start: 27271 PA14_00270*,PA14_00290 -,+
Extrapolated Insert Location: 27332 PA14_00270*,PA14_00290 -,+
Default Offset Location: 27334 PA14_00270*,PA14_00290 -,+
PAO1 BLAST Hit ID: 27212       Show Transposon Map
Identities: 437/450 (97.11%) BLAST Bit Score: 789.0 Percent of Processed Sequence That Aligns: 99.78%
Query Start: 1 Query End: 450 Subject Start: 27797 Subject End: 27348 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 27797 PA0026 -
Raw Sequence Start: 27869 PA0026 -
Extrapolated Insert Location: 27808 PA0026 -
Default Offset Location: 27806 PA0026 -
PAO1 BLAST Hit ID: 27213       Show Transposon Map
Identities: 22/22 (100.00%) BLAST Bit Score: 44.1 Percent of Processed Sequence That Aligns: 4.67%
Query Start: 228 Query End: 249 Subject Start: 27549 Subject End: 27570 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 27549
Raw Sequence Start: 27250 PA0025 +
Extrapolated Insert Location: 27311 PA0025 +
Default Offset Location: 27313 PA0025 +
PAO1 BLAST Hit ID: 27214       Show Transposon Map
Identities: 26/28 (92.85%) BLAST Bit Score: 40.1 Percent of Processed Sequence That Aligns: 6.00%
Query Start: 347 Query End: 374 Subject Start: 2509831 Subject End: 2509858 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 2509831 PA2281 -
Raw Sequence Start: 2509413 PA2280 +
Extrapolated Insert Location: 2509474
Default Offset Location: 2509476
H PA14 Blast Hit H PAO1 Blast Hit