Mutant Report for Mutant ID: 26100

Strain: PA14 Genetic Background: Wild Type Transposon: MrT7 Library: lib_09_03
Raw Sequence ID: 9876
Chromat Path: H:\Pa14\MrT7\272v1\272v1_G12_G12_098.ab1 Last Transposon Base: 63 Transposon Sequence
Match Quality: 0
Raw Sequence:
(Transposon Sequence in Red)
TGTTCAGTTTGTATACGACTCCTATAGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTACATGCG
CAACCATATCGACCTGGACGATCTCGAGCGCCGCGCGCGCTTCCCGCAACCCTGAGCACGAGGGCACTTC
CATGAACCGGCTTCCCACCTGCCTGCTGGCCGCCACCCTGTTCCTGGGCAGCGCCTCGCTATACGCCGAA
GACCCCGCCTGTGCCCGCGTCAGGCTGGCCGATCCAGGCTGGAGCGATATCGCGGTGACCAACGCCACCG
CCGCGTTTCTCCTGGAAAGCCTCGGCTACCAGGTGAAGATCGATACCCCCCCCCCCCATCATCTGCAGGC
CTGGCCAAANNNNNNNNTNNNNGNNNNNNNNNNNNTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Blast against PA14
Processed Seqquence ID: 6000
5' Trim Position: 9 3' Trim Position: 353
Processed Sequence:
(Transposon Sequence in Red)
TGTATACGACTCCTATAGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTACATGCGCAACCATAT
CGACCTGGACGATCTCGAGCGCCGCGCGCGCTTCCCGCAACCCTGAGCACGAGGGCACTTCCATGAACCG
GCTTCCCACCTGCCTGCTGGCCGCCACCCTGTTCCTGGGCAGCGCCTCGCTATACGCCGAAGACCCCGCC
TGTGCCCGCGTCAGGCTGGCCGATCCAGGCTGGAGCGATATCGCGGTGACCAACGCCACCGCCGCGTTTC
TCCTGGAAAGCCTCGGCTACCAGGTGAAGATCGATACCCCCCCCCCCCATCATCTGCAGGCCTG
Blast against PA14
BLAST of Processed Sequence against PA14 And PAO1 Genome Sequence
26891 26891 26892 26892
PA14 BLAST Hit ID: 26891       Show Transposon Map
Identities: 263/263 (100.00%) BLAST Bit Score: 521.0 Percent of Processed Sequence That Aligns: 76.16%
Query Start: 54 Query End: 316 Subject Start: 33083 Subject End: 32821 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 33083 PA14_00370*,PA14_00380 -,+
Raw Sequence Start: 33145 PA14_00370*,PA14_00380 -,+
Extrapolated Insert Location: 33082 PA14_00370*,PA14_00380 -,+
Default Offset Location: 33082 PA14_00370*,PA14_00380 -,+
PAO1 BLAST Hit ID: 26892       Show Transposon Map
Identities: 261/263 (99.23%) BLAST Bit Score: 505.0 Percent of Processed Sequence That Aligns: 76.16%
Query Start: 54 Query End: 316 Subject Start: 33062 Subject End: 32800 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 33062 PA0031 +
Raw Sequence Start: 33124 PA0031 +
Extrapolated Insert Location: 33061 PA0031 +
Default Offset Location: 33061 PA0031 +
H PA14 Blast Hit H PAO1 Blast Hit