Mutant Report for Mutant ID: 25950

Strain: PA14 Genetic Background: Wild Type Transposon: MrT7 Library: lib_09_03
Raw Sequence ID: 9726
Chromat Path: H:\Pa14\MrT7\271v1\271v1_C06_C6_050.ab1 Last Transposon Base: Transposon Sequence
Match Quality:
Raw Sequence:
(Transposon Sequence in Red)
TGTCAGTTTCGATACGACAAGTATAAGATGTTGCATGACCGCGGCATGTAATCAGCAAGCCGAAAAACAA
GGAGAACACGCACGCATACCCCGAAAGGGCGTCGTCTGCTGTGCCGGGCCAAGGGGCAGAGCACGTCACC
CAACTGTCCGGCGGGGATCGCATAGGGCCGCGCCTGTTCCGCCGCCGCTTCGGCGGCCGAGGCGCAGAGC
GGCGCCGCGCCGGCCGCCATGGCCAGCGACAGCAGGGCCGCGCGCACCGAACGGCTCAGGCGCGAGGCGC
GGGGGAAATCGAGGGACGACGGGGCATTGCGGAGGACGACGGCGGTGGCGGTCATGAACGGAATCCGTTG
GAGTCGTTGAAGGGTGTTCAATCGATAAAGCCGGACCAGTCGCGGAAAGCCGACAAAAATAATGAAAATA
ATTTTCAGTGCGTTTCGCTCCGGGCGGAAGCAAGCGTCCACGCGGCCGCCGGCGCGACTCAGGCGGCGAC
CACCCTCACCCACCAGCGGGTATGCCGCTGCAGGCGCACCGGCAGGGTCCGCGCGAGCACCTGCAACAGC
TTGTCGGTGTCGTCCAGGCGGAAGACCCCGGACAGACGCAGGTCGGCGACCTCCCCGGCGCAGCCGAAGT
AGCCGTTGCGGTAGCGGCCGACCTCGGCGAGGAAGTCGGCCAGGCGCATGTCGCGAGTGAAGATCAGGCC
CTCGGCCCGAGCACGGGTCCATCTTGCGGCGTTCGGGCCCCGCAGCCGTCGGGGGGAATCGATTAGTTCT
GCCCGCCTTGGTCTCGGAACCTGCAAGGAAGCGCGCCGAAAGGTCCTAGCCCACTAAACCTTTTTACGTG
AAAAAGTGGAGGATCATTAGGGGGCTGGTGAAAGAATTCAGTGTTTTAATCAGTG
Blast against PA14
Processed Seqquence ID: 5858
5' Trim Position: 120 3' Trim Position: 571
Processed Sequence:
(Transposon Sequence in Red)
AAGGGGCAGAGCACGTCACCCAACTGTCCGGCGGGGATCGCATAGGGCCGCGCCTGTTCCGCCGCCGCTT
CGGCGGCCGAGGCGCAGAGCGGCGCCGCGCCGGCCGCCATGGCCAGCGACAGCAGGGCCGCGCGCACCGA
ACGGCTCAGGCGCGAGGCGCGGGGGAAATCGAGGGACGACGGGGCATTGCGGAGGACGACGGCGGTGGCG
GTCATGAACGGAATCCGTTGGAGTCGTTGAAGGGTGTTCAATCGATAAAGCCGGACCAGTCGCGGAAAGC
CGACAAAAATAATGAAAATAATTTTCAGTGCGTTTCGCTCCGGGCGGAAGCAAGCGTCCACGCGGCCGCC
GGCGCGACTCAGGCGGCGACCACCCTCACCCACCAGCGGGTATGCCGCTGCAGGCGCACCGGCAGGGTCC
GCGCGAGCACCTGCAACAGCTTGTCGGTGTC
Blast against PA14
BLAST of Processed Sequence against PA14 And PAO1 Genome Sequence
26044 26044 26045 26045 26046 26046 26047 26047
PA14 BLAST Hit ID: 26044       Show Transposon Map
Identities: 443/443 (100.00%) BLAST Bit Score: 878.0 Percent of Processed Sequence That Aligns: 98.00%
Query Start: 9 Query End: 451 Subject Start: 2842352 Subject End: 2841910 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 2842352 PA14_32740,PA14_32730* -,+
Raw Sequence Start: 2842480 PA14_32740,PA14_32730* -,+
Extrapolated Insert Location:
Default Offset Location: 2842417 PA14_32740,PA14_32730* -,+
PA14 BLAST Hit ID: 26045       Show Transposon Map
Identities: 20/20 (100.00%) BLAST Bit Score: 40.1 Percent of Processed Sequence That Aligns: 4.21%
Query Start: 47 Query End: 66 Subject Start: 3272535 Subject End: 3272554 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 3272535 PA14_36720*,PA14_36730 +,-
Raw Sequence Start: 3272369 PA14_36720*,PA14_36730 +,-
Extrapolated Insert Location:
Default Offset Location: 3272432 PA14_36720*,PA14_36730 +,-
PAO1 BLAST Hit ID: 26046       Show Transposon Map
Identities: 435/443 (98.19%) BLAST Bit Score: 815.0 Percent of Processed Sequence That Aligns: 98.00%
Query Start: 9 Query End: 451 Subject Start: 2785019 Subject End: 2785461 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 2785019 PA2466 -
Raw Sequence Start: 2784891 PA2466 -
Extrapolated Insert Location:
Default Offset Location: 2784954 PA2466 -
PAO1 BLAST Hit ID: 26047       Show Transposon Map
Identities: 20/20 (100.00%) BLAST Bit Score: 40.1 Percent of Processed Sequence That Aligns: 4.21%
Query Start: 47 Query End: 66 Subject Start: 2370859 Subject End: 2370840 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 2370859 PA2152 -
Raw Sequence Start: 2371025 PA2152 -
Extrapolated Insert Location:
Default Offset Location: 2370962 PA2152 -
H PA14 Blast Hit H PAO1 Blast Hit